Microarray Probes on PGSC0003DMT400025690

Probe IDChipProbe Sequence
CUST_7381_PI426222305 JHI_St_60k_v1 CCCTTTAGCTATATGTAATTAATTCAGGTTGCTTTATTCTGAAACCTGCATGTTGCTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025690

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025690 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G76420.1 +1 3e-95 293 159/269 (59%) NAC (No Apical Meristem) domain transcriptional regulator superfamily protein | chr1:28672029-28673835 REVERSE LENGTH=334

Transcript Sequence (1331 bp)

>PGSC0003DMT400025690 1331 pgsc_dm_v3.4
CCTATTTTGTTTTGTTTTGTACTATATAAATGCATGCTACCTCCACTTTAATTTGTTATT
ATTATAACCACATATCTTGAAAATCAATCACTTTTTAGAGTTAGAGAAGAGATGTTGGCA
ATGGAAGAAATATTGTGTGAACTGAATAGAGAGGAGATGATGAATGAACAAGGTCTTCCA
CCTGGTTTTAGGTTTCATCCTACTGATGAAGAGCTTATCACTTTTTACTTAGCCTCTAAG
GTCTTCAATGCTACTTTTTCTGCTGGTATTCAAATTCCTCAAGTTGATCTCAACAGATGT
GAACCCTGGGAGCTTCCAGAAGTGGCAAAGATGGGTGAAAGAGAGTGGTATTTTTTTAGC
TTGAGGGACCGGAAATACCCAACCGGGTTAAGGACGAACCGGGCAACCGGAGCGGGTTAT
TGGAAAGCAACCGGTAAAGACCGTGAAGTTTACAGTGCAACTAACGGAGCACTCCTTGGA
ATGAAGAAAACACTTGTTTTTTACAAAGGAAGAGCTCCAAGGGGTGAGAAAACTAAGTGG
GTTATGCATGAATACCGTCTTGACGGTGATTTCTCTTACCGTTACTCTTCTAAGGAGGAA
TGGGTGATATGCAGAATACTACACAAAGTAGGGGAGAAGAAAAATGCAATATATGAAGGG
GCAGGTGGTGGTGGTGGGTCTACATACCCTACTTTAAAAACATGGTCATCATCAGCAGCA
GTGAATTCACCTTTAACAACAAATCCAAAAACATTACAAATATCACACAATAACCATTAT
CTATTTCAGCACCATGAAAATGACCTATTGAAATCCCTCTTTAATGTTTCCCAAACAACA
AACCTATTACCAATGAATAATAATGTTGCCTTTTCCTCAACCAAAAGATACAAAGACAAC
AAACAAGAGGAGGAGGATATGACAAACAAAAACTCATCCAATAGCGTTGTGATCAATCAA
CAAATTTGCATGAAATCATCACAAGGCAACTACTTATCTTCTCCGTTATGTTACAACAAT
AATGATCAAAATGATGCTTTTGTGATGAATAATTCCGATTGGAGTAGTAGTTTAGCGGGA
ATGGAGGAGGGGATTATACCATGCAATTATTTCAATAATGTTGTGATGGATAATTGTCCC
ATCAAAATTGCTGCAGAATCTTGGCCTCTCCATCTCTAGTAGTATGTACCTAGGGAGTAA
TTAATTATGACTAGTGTTATGTCATCCCTATAATATAAAGAGCTACCCTTTAGCTATATG
TAATTAATTCAGGTTGCTTTATTCTGAAACCTGCATGTTGCTTGTTCCTTTAGTTTTTTT
ATATATGTAAG