Microarray Probes on PGSC0003DMT400025543

Probe IDChipProbe Sequence
CUST_7447_PI426222305 JHI_St_60k_v1 GCTCTCCTAATTGAGCGGGACTTAATTTCTGATCGTAACTCAAATCTGAAATTTCGAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025543

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025543 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G17880.1 +2 6e-26 101 69/159 (43%) Chaperone DnaJ-domain superfamily protein | chr2:7767176-7767658 REVERSE LENGTH=160

Transcript Sequence (796 bp)

>PGSC0003DMT400025543 796 pgsc_dm_v3.4
CTAATAAATAGGAATATGTTCTTCCATTTTTTCCATCTATCCAAAACATTCACTCTATCA
TTTTCTCCAGTAACTAACCAAATTCTTCTAGAACAATTATTCCAAAATCATGGCTTCTTC
TTCTTTTCTTCTCTCCACTTCAATTGCCGGCTCTAAACTCTCCGCCGCTGCACCACCGTC
GCGCTCCGTTAGCTTCCGGCAGCGGCCGTTCTCTGTTTCCGCCGCTTACTCCACTGCGGA
GAGGACTTCTACTACTACTACTAGTAGTAGCTCTACAATAGCCTCACATACATCGTTATA
CGAAGTTTTAGGGATTCAAATAGGAGCTAATTCTCATGAAATTAAATCTGCTTACCGGAA
ATTAGCCAGAATTTTGCATCCGGATGTTCAGAATTCGTCGGCGGAGGACTTTATTAGAGT
TCAATCAGCGTATGCTACTCTTTCCGACCCGGAAAAACGTGCTAATTATGATCGGAAACT
ATTTGGGAATAGAATTGCAAGGCCAGTTGATTTCTCACCGGCGGGAGCTCGTAGCCATTA
TACTGTTCGCCGGAAATGGGAAACCGATCAGTGTTGGTAGATTTTTTTCGAAATCTCCCG
CCCGATTAGTCATAAAATGTAGATTTTAGCTCTCCTAATTGAGCGGGACTTAATTTCTGA
TCGTAACTCAAATCTGAAATTTCGAATTAAGAGTAATAAGATCAGTTATTTGTACAGTAC
ATGTAAATGTGACTTTATGTATATATTACTTTAAATTTTTGTTATGTTATTTGTGTGGAA
GATAAATAATCAGACG