Microarray Probes on PGSC0003DMT400025521

Probe IDChipProbe Sequence
CUST_7889_PI426222305 JHI_St_60k_v1 GTATTTAATCCAAGGGCTATACTTCCATGCTTTGTCGTGATATACGAAGCATTGGAATCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025521

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025521 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G75710.1 +1 7e-128 377 201/301 (67%) C2H2-like zinc finger protein | chr1:28428806-28431128 FORWARD LENGTH=462

Transcript Sequence (945 bp)

>PGSC0003DMT400025521 945 pgsc_dm_v3.4
TCATCTTCAAGTTCGAGGTCTCTTGCTAGATCAAACGGTGGTGGTAGCTCCACGTGTACT
ACTTCATCAAGAGGAATGCAGTTTCGTAAGCTATCTGGATGTTATGAGTGTCACATGATA
GTAGATCCTAGCAGGTACCCTTTACCAAGGTCAACAATATGTGCATGTCCTGAATGTGGA
GAAGTTTTTCCAAAAATTGAGAGCTTAGAACATCATCAAGCAGTTAAACATGCTGTGTCA
GAGTTGGGTCCGGAAGATTCAAGCCGTAACATAGTGGAGATAATCTTCAAATCAAGCTGG
CTCAAGAAGGATAATCCAATCTGTAAGATCGAACGGATATTAAAAGTCCACAACACCAAA
CGTACGATCCAACGGTTCGAGGACTGCAGGGACGCGGTGAAGATACATGCAGTCGCCACA
GGGAAGAAAAACCCAAGATGCGCCGCTGATGGAAATGAGCTCCTTAGATTTTACTGCACG
AGCCTTACATGCACCCTCGGTGCACGTGACTCGTCCAGCTTGTGTGGCTCCGTACCCGGC
TGTGGAGTTTGCACTACCATACGCCACGGCTTCCAAGGAAACAAAACTAATGGGGTCCGC
ACAACTGCTAGTAGTGGGCGGGCCCATGATTGTCTCGGTAGTGGTATGGCCCGACGCAGG
GCGATGATCGTGTGTCGGGTCATTGCTGGCAGAGTCAAGCAGACCGCAAAAGATGTGAGG
GCTTCTCCCACGACAGAGGAGGAGAATTGCTCTGGCTCTGGCTCTGGTTCTGGTTCTGGT
TCTGGTTCTGGTTCTGGTTCGAGCTTGTCAGCTACTGACTCTATCGTATACGATTCGGTA
TCCGGACATGCAGGGATCTACTCAAATCTCGAGGAATTATACGTATTTAATCCAAGGGCT
ATACTTCCATGCTTTGTCGTGATATACGAAGCATTGGAATCTTAA