Microarray Probes on PGSC0003DMT400025452

Probe IDChipProbe Sequence
CUST_28852_PI426222305 JHI_St_60k_v1 GCTGTTCCAACTTATAGGCTACAACACAGCTGATTTTGGGAAATTGATTTTTATACATCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025452

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025452 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36220.1 +2 2e-44 155 72/132 (55%) ferulic acid 5-hydroxylase 1 | chr4:17137584-17139619 REVERSE LENGTH=520

Transcript Sequence (548 bp)

>PGSC0003DMT400025452 548 pgsc_dm_v3.4
TGCTGCCCCATTACTACTTCATGAAGCCATGGAAGATTGTATGGTAGATGATTTCTATAT
CAAAAAAGGATCACAAGTTATTGTCAATGCATACACTATTCATAGGGATCCTAATTTTTG
GACCGACGCTGATAAGTTTTTGCCAGAGAGATTTCTTGAAAGTAACGTAGATGTTCGTGG
ACGTGATTATCAACTTTTACCATTTGGTTCTGGCAGAAGAAGTTGCCCCGGGATGCAATT
GGCATTAATTATTGTTCGTCTTGTTGTAGCACAATTGGTTCATTGCTTTGATTGGGAACT
CCCAAATGAGATGCAGCCTAAGGATTTGGATATGACTGAGCAATTTGGTATAGTTACAGG
CAGGGCAAATCATTTAATGGCTGTTCCAACTTATAGGCTACAACACAGCTGATTTTGGGA
AATTGATTTTTATACATCTAGTTATAATAATTTATATGATCTTGTATAATAAAGTTTGTT
TAGTGATTTTGATTGATTACTTCTTTGTATGCAATAAATATGTTATTGTTTTTGTTATTA
CTTCTGAT