Microarray Probes on PGSC0003DMT400025116

Probe IDChipProbe Sequence
CUST_30599_PI426222305 JHI_St_60k_v1 TATAGTAAACTCATTAGTAATTCTCACTATCTCCTCTTCTCTCCTAGTTCTCCACAACGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025116

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025116 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G18210.1 +3 7e-105 320 179/353 (51%) purine permease 10 | chr4:10076175-10077495 FORWARD LENGTH=390

Transcript Sequence (1291 bp)

>PGSC0003DMT400025116 1291 pgsc_dm_v3.4
TTTTCAACAAGAATTCTTTCTTTCTTTCTTTTTACCAAGTGTATGAGATGGGGGATTCTT
CAGCAGTAGAGCAATCACTAGTACAAGGTGAAGAAGTTAAAAGGGAAGAAATCATCTCTC
AAAATGAATCTCAATTAAACGGTCCAACTTTGGTACATTATAAATGGTGGATCCAAATGA
TCATTTATTCAACATTAGTTCTATCTACCCAAGCTATAGGTACACTTTTAGGTAGAATAT
ATTTTGAAAAAGGTGGAAATAGTAAATGGTTAGCCACATTAGTACAAACTATAGCCTTCC
CAATTCTCATCCCTTTCCTTTTTATAAAACCAAAAAAAACTAATAAAAATATTGAAATAA
TTAAAAAACCCTCTTTTATAATTGTTTCTTCACTTTATACTATACTAGGTTTATTTATAG
CTGGAAATTGTATGTTATACACTATAGGTCTACAATATCTTCCTGTTACAACTTATTCAC
TTATTTGTGCTAGTCAATTAGGTTTCAATGCCATTTTTTCATACTTCCTAAATAAACAAA
AATTCACCCCTTATATAGTAAACTCATTAGTAATTCTCACTATCTCCTCTTCTCTCCTAG
TTCTCCACAACGACGATTCTAGTGAACGTACCAATAATAAAACATCTAGACAAAAATATA
TATTCGGATTTTTGTCTACATTAGCTGCCTCTGCTGGCTACGCGTTGATGCTTTCTATAA
CACAACTCGCTCTTCAAAAAGTCTTTAAGAAAGAAAGCTTTCGTTTGATCATAGAAATGT
CAACTTATCAGTCGATAAGTGCGACTATGGTATTATTAATAGGGCTTTTCGCTAGCGGGG
AGTGGAAAAAGTTAGTGAAAGAAATGAATGAATATGAATTAGGGAAAATTAGTTATGTTT
TAAACTTAATTGGGACATCTATTTGTTGGCAATTTTATACAGTTGGTTCAGTAGGGTTAA
TTTTTAAAGTGTCTTCATTATTTTCAAATGTAATTAGTATATTAGGTTTGCCTGTGGCTC
CTGTTTTGGCTGTGATATTTCTTCATGACAAGTTGAGTGGTATTAAAGTGATGTCAATGG
TGTTGGCAATTTGGGGATTTGTGTCATATATGTATCAACATTATCTTGATGATTTAAAGG
ACAAGGCTGAAAAAAGGGGGAAATTAGTGGAGCTTTCTGAAGTTAATAATCTCATTGAGA
GAAGTTAAATTAGTATATGACATTTTGTATTAATTATATTGTATCTATAGTTCATGAAAT
TCATAACTTTTTCATATCTCATGTGGTATAA