Microarray Probes on PGSC0003DMT400025099

Probe IDChipProbe Sequence
CUST_48972_PI426222305 JHI_St_60k_v1 TCTAGACAAGCTTGGAGTATTGAATCTCTTCAGTACATCCAACTTGAGGGGCAGTATTGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025099

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025099 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G23160.1 +1 3e-51 187 87/183 (48%) cysteine-rich RLK (RECEPTOR-like protein kinase) 8 | chr4:12129485-12134086 FORWARD LENGTH=1262

Transcript Sequence (1222 bp)

>PGSC0003DMT400025099 1222 pgsc_dm_v3.4
GTAATTTTGAGTGTTTAGATGATGCTCTGATTCTCTTTAAGCAAATGGTTACAATGAAGC
CTCTTCCTTCTCTTGTCAATTTTTCTAAATTATTTAAGACTATGATAAATTTGAGATCTG
CCCAGACCATAGTTGCATCTGTAGCATATACTATCCCACTAAGCAATTCCTTTGATACAG
TATTCATGATCCAAGCTAACACGAAGGCATTACATTTTTCTCACTGCTCTTCCAATTCTC
CCTCATAATCACTCCTCCTACATGTTCCTAATACAAACCCCAACTTACTTTTAGCCCTAA
GATTAATCATCATGGATCTGCTCCATAAAGAATAATTTTCAGTTCATGTAAGTTGCACGG
TGGTGAATATAGAGTATAGAGTATGATCAGAATTCACAAACCACTGATGTTTTATATGCA
GATGTTTCTAGATACCAAAGACTTGTGGGCAAGTTGTTATACCTTACCAATACAAGACCA
GATATAGCTTTTGCTTTACAGTCCTTGAGCCAGTTCATGCAACGACCAAAGATGTCACAC
TGGATTTCTGCCTTAAGAGTAATCAAGTATATCAAACTTGAACCTAGAAGAGGATTATTA
ATGAGTTCTGATAGCAAGCCCCATTTGACAGGTTATTGTGACGCAGATTGGGCTGCATGT
CCAAATACTAGAAGGTCTGTAATAGGTTTTGTATTGAAATATGGTTATTCACTCATATCT
TGGAAGTCCAAGAAGCAAAATACAGTGTCAAGGAGCTCTGCAGAAGCTGAGTACAGGAGT
ATGGCTAGTCTGACAGCTGAAGTAGTGTGGATTGCAAGTCTATACAAGGAGCTAAGAGTA
AAATTGATTGAACCAGCTTCTATATACTGTGATAGCAAGGTTGCTATACAGATTGCTGCA
AATCCTGTGTTTCATGAGCGTACTAAACACATCGAGATTGATTGCCATTTCATTCGAGAG
AAAATTAAAAAAGGTCTCATCCAAACTAACTATGTCAACACTAAGGATCAGCAAGCTAAT
TTGTTGACTAAGGCACATGGAAGATCACAGCATGAGTTTCTTCTAGACAAGCTTGGAGTA
TTGAATCTCTTCAGTACATCCAACTTGAGGGGCAGTATTGGAATTGATTAAGTGATTGAT
CAATTCTGTTAGTTAGGTAGTTAATTGATTAACTCTGATAGTTAGTGAAATGGTTAGTTT
AGGTGTTTAATTAACTAGTCTG