Microarray Probes on PGSC0003DMT400024931

Probe IDChipProbe Sequence
CUST_50655_PI426222305 JHI_St_60k_v1 GTTGCTCATCTTCTCAGAAACAATGATGAACCAACACCAAGATGAAGCCCGTCTATTCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024931

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400024931 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G72860.1 +1 6e-32 130 60/108 (56%) Disease resistance protein (TIR-NBS-LRR class) family | chr1:27417096-27420778 REVERSE LENGTH=1163

Transcript Sequence (1338 bp)

>PGSC0003DMT400024931 1338 pgsc_dm_v3.4
AATTTTTTGTGTTTTTTTTCAAAACGTACAATTGAATCCATGGCATCTTCTTCTTCTTCT
TTTGCGAGTGATTCACAAAATTATCCTCTATGGAAGTATGATGTCTTTCTAAGTTTTAGA
GGTAAGGATACCCGTAAAACATTTACGAGTCACTTGTACGAAGGCCTGAGAAACAGGGGA
ATATTCACCTTTCAAGATGATAAACGGCTAGAGCAAGGCGATTCCATCTCACAAGAACTC
TTGAAAGCTATCGAAGAGTCTCAAGTTGCACTCATCGTTTTCTGAAGGAACTATGCTACG
TCGAGGTGGTGCTTGAATGAACTAGTGAAGATCATGGAATGCAAGGAGGAAGAAAGTAGA
CAAACAGTCATACCGATCTTCTATGATGTGGATCCATCACATGTTCAAACCAAAGTGAGA
GCTTTGCAGTAGCATTGTAACAACTAGAAACAGACAATTGATAGAGAAGGATGCTGCAAT
ATACAAAGTGCCTACACTACCTGACCATCATGCTATGCAATTGTTCAATAAGCATGCTTT
TAGAAAAGAAGTTCCAAATGAGTGTTTTAAGAAGTTATCGTTGGAGGTAGTAAATCAGGC
TAAAGGCCTTCCTTTAGCCCTCAAGGTGTGGGGTTCTTTGCTGCACAAGAAAGGCCTAAC
TCAATGGACAAAAACTGTAGACCAAATAAAGAAAAAGTCTAATTCAGAAATTGTTGAAAA
ACTCAAAATAAGTTATGATGGGTTGGAGCCCCAAAGAGCAAAAGATATTTCTAGATATCG
CATGTTTCTTCCGTGCGTATGAAAGAAAACAAGTCATGAAAATTGTTGATAGCCGTGATT
TTGGAGCTGAATACGGATTAGATGTTCTAATTGAAAAATCCCTTGTGTTCATCTCTAAAT
ATGACAGAATTGAAATGCATGACTTGATTGAAGATATGGGCAAATACATAGTGAAAATGC
AAACAAATTCTGGAAAACCTACCAGAGTATGGAATGTTGAAGATTTCGAAGATGTTATGA
TGGACAATATGGGGCCTTATCCAACCATCCAGAATGTCCTGCAGAATCTGCTATGCATTT
TTTCTTGATACCTCTTGCTGGCTTATGGGATACATCCAAGGCAAATGGAAGAACACTGAA
TGACTATGGGCACATTAGGTTATATACCCCTGGAGAAAGGAATGAGCTTGGATAAAGATG
AACCTAAGATTGAGGTCAGTTGCTCATCTTCTCAGAAACAATGATGAACCAACACCAAGA
TGAAGCCCGTCTATTCAGAAACTTTGCAGCTCTTTCCCACAAGCCCAGGATATTAGCTTA
AATATAGGTAGGTATATA