Microarray Probes on PGSC0003DMT400024887

Probe IDChipProbe Sequence
CUST_21815_PI426222305 JHI_St_60k_v1 GCTGCCAGAAAAGATGACCTTATTTTGGTTGCCACTCCTTATCAACCACCTCAACAATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024887

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400024887 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G26310.1 +1 1e-123 374 203/458 (44%) cytochrome P450, family 71, subfamily B, polypeptide 35 | chr3:9641089-9642779 REVERSE LENGTH=500

Transcript Sequence (1512 bp)

>PGSC0003DMT400024887 1512 pgsc_dm_v3.4
ATGCAATTCTTGAGCTTGGCTTCCATCTCCCTTTCTCTATCTTTTCTGTTTTTGTTAAGG
AAATGGAAAAACTCGAATAGCCAATCGAAAAAATTGCCTCCAGGTCCATGGAAACTTCCT
TTACTAGGAAGTATGCTTCATATGGTTGGTGGACTTCCACACCATGTCCTTAGAGATTTA
GCCAAAAAATATGGACCACTTATGCATCTTCAACTTGGTGAAGTCTCTGCAGTTGTAGTA
ACTTCTCCTGATATGGCGAAAGAAGTACTAAAAACTCATGACATCGCTTTCGCCTCTAGG
CCTAAACTTTTGGCCCCGGAAATTGTCTGTTACAACAGGTCTGACATTGCCTTTTGCCCC
TACGGAGATTACTGGAGACAAATGCATAAAATTTGTGTCTTGGAATTGTTGAGTGCCAAG
AATGTCCGGTCATATGGCTCGATTAGGCGTGATGAAGTTGATCGTCTAGTTAATTTAATC
CGGTCATCTTCGGGTGAGCCGGTTAATTTTATTGAAAGGTTGTTTTTGTTCACAAGTTCA
ATGACATGTAGATCAGCGTTCGGGAAAGTGTTCAAAGAACAGGACAAATTTATACAACTA
ATCAAAGAAGTGATTGGGTTAGCAGGAGGATTTGATGTGGCTGACTTATTTCCATCACTG
AAGCTTCTCCATGTGCTTAGTGGAATGAAGGGTAAAATAATGAATGCTCATCATAAGATA
GATGCAATTGTTGAAGATGTCATCAATGAGCACAAGAAGAACATTGCAATGGGGAAAACT
AATGGTGCATTAGGTGGTGGTGAAGATCTAATTGATGTCCTTATAAGACTTATGAATGAT
GGAGGCCTTCAATTTCCGATCACCAACGTCAACATCAAAGCTATTATTTTCGACATGTTT
GCTGCAGAAACAGAGACTTCATCGTCAACACTTGACTGGGCAATGGTGCAAATGATGAAA
AACCCAAGTGTAATCGCCAAAGCTCAAGCAGAAGTGCGAGAAGCCTTTAAAGACAAAGAA
ACGTTCGATGAAAATGATGTAGAGGAGCTGAAATACTTAAAGTTAGTCATTAAAGAAACT
CTAAGACTCCATCCACCAGTTCCACTTTTAGTCCCAAGAGAATGTAGGGAAGAGACGGAT
ATAAACGGCTACACTATTCCTGTGAAGACCAAAGTCATGGTTAATGTTTGGGCATTGGGG
AGAGATCCAAAATATTGGGATGACGCAGAAAGCTTTAAGCCAGAGAGATTTGAGCAGTGC
TCTGTAGACTTTATTGGTAACAATTTTGAATATCTTCCCTTTGGCGGTGGGAGAAGGATT
TGTCCCGGGATATCATTTGGCTTAGCTAATGTTTATTTGCCGTTGGCTCAATTGTTATAT
CACTTCGACTGGAAACTCCCTATCGGAATGGAGCCAAAAGACTTAAACTTGACTGAGTTG
GTTGGAGTAACTGCTGCCAGAAAAGATGACCTTATTTTGGTTGCCACTCCTTATCAACCA
CCTCAACAATGA