Microarray Probes on PGSC0003DMT400024479

Probe IDChipProbe Sequence
CUST_27495_PI426222305 JHI_St_60k_v1 AAATTAGAATGGACTGTGAAGGTTGTGCTCGTAAAGTCAAGAATGCTCTCTCTAAAGTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024479

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400024479 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G08570.1 +2 2e-54 177 89/151 (59%) Heavy metal transport/detoxification superfamily protein | chr4:5455123-5455975 REVERSE LENGTH=150

Transcript Sequence (888 bp)

>PGSC0003DMT400024479 888 pgsc_dm_v3.4
AGCAAATATAATCCACCACCAAAAAAACACAAAATTAATTTCTCATCCTTTCTCAGCTTT
ATAATTTTTAAAGTTAATTTCTTGTTTATATCAAAAGCAAAAAATGGGAGTTTCAGGGAC
ACTCGAGTACTTGTCTGAAGTACTTAGCAACGCTAAGAAGAGTAAGAAAAAGAAACAAAT
TGCAACTGTATCCATCAAAATTAGAATGGACTGTGAAGGTTGTGCTCGTAAAGTCAAGAA
TGCTCTCTCTAAAGTAAAAGGTGCAAAATCAGTGGATGTGGACTTAAAGCAACAGAAAGC
AACAGTAACAGGCTTTGTGGAGCCAAAAAAAGTGTTGAAGGCAGCACAATCCACTGGCAA
AAAATGTGAAATTTGGCCATATGTGCCATATAGTATGGTGGCACATCCTTATGCTGCTGG
TGTTTATGACAAAAAAGCACCTCCTAATTTTGTAAGGGCAACTACTGATCCTTCTGTTGC
TCACTTAAATCCTGTTGAAGAACAATATTCCCTTATGTTTAGTGATGAAAATCTAAATGC
TTGTAATATTATGTAGTAGTTAATTATAATTTTTTTTCTTTGTTATAAAGTATATATACT
TCTTTATGTGTATTTTTATGTATACTTAAAACCTGTTGAAGAACAGGTAGGCTATGATAC
ATGGACGTGCAAGTATTTTTATATGTTTCATAGAAGTATTTAGCTTTAACTTCATGTATC
TATTATATGTATTTAGTATTAATTTGATATATAAAGTATCAATTTCTTAGGATATATTCA
AAATACATGTATGTAGTATCAACATACATGCATGTATCTACATATGAAATGTAACTGAAA
CATATCAAATTACGAGTAAATCATGACTATAGAGTACTTGCCGTATCA