Microarray Probes on PGSC0003DMT400024347

Probe IDChipProbe Sequence
CUST_46693_PI426222305 JHI_St_60k_v1 TCTTGGCTGAGCTTACTATTATCAATCGTCTTCGACATAAACATCTTGTCAAATTGCTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024347

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400024347 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G06740.1 +3 2e-130 418 246/623 (39%) Concanavalin A-like lectin protein kinase family protein | chr5:2084094-2086052 FORWARD LENGTH=652

Transcript Sequence (3679 bp)

>PGSC0003DMT400024347 3679 pgsc_dm_v3.4
CTCCATTTTTCACTCATTGATCAATTATTTTATTTGCATTTACAAAAAAGTAAGACAAAG
CCAACGTGCTTCAAAGTTTCTGCTCATTGATTCTTTCTTCTTCCCCTGTTTTCTTGCCCA
TCACCAAATCTACTTCCTCTGTAGCCACCACCATCTCTGAAGGGACTCACTGCTGATGAA
AAATGGGATTGTTAACACCAAAAACACTCACCATTTTCATCATTCTCTTCTCTTTACTAC
ACCTCAAACTTCAAGCTCAAAAAATGGAACATTACAACCTAGAATATGCATCTTTTGATC
AAACTTTCTTTGACATCTTTGAAGTTGAAAGTCCTGCAACAATCAGTAACTTTGCTCTCC
AAGTAACCCCTGATTCTGCTTCTTCAGATTTCAATCTCTACAATAACTCAGGAAGAATCC
TCTTTAAGCGACCATTTAAGCTCTGGGATGGTGATGTTTTAGACAATAAAACAAGGGTTG
CATCTTTCAACTCTTCTTTTCTTGTCAACATTTACAGACCAAAGAATGAAACAGCTGCTG
AAGGGTTAACATTCTTGATTTCACCAGATTTGGAGAAGCCCGATAATAGCCAGGGCCAGT
ATTTAGGGTTAACAAATGCTACTACAGATGGGAAATCTAGTAACAAAGTTGTTGCTGTTG
AGCTTGATACTTCTAAACAAAGCTTTGACCCTGATGGTAACCATATAGGTATTGATGTTC
ATAGTGTTAGATCTGTAAAGGTTGAATCTTTAACACCCCTTGGTATAGAACTTGCTCCTA
TGGGTGCAAGATTCTATAATGTTTGGGTACAATATGATGGAATCAAGAAAGTTCTTGATG
TTTATATTGTTGAACAAGCACAGAAAAATGGGTCTACCCCACCTATACCAAAAACCCCCA
TTTTAACATATAATCTTGATTTGAAAGAACATGTAAATCAAGAATCATATTTTGGGTTTT
CTGCATCAACTGGGACTAACTACCAACTCAACTGTGTATTGAGATGGAACTTAACAGTTG
AGTACTTCCCAGAAAAGAAAAGTCCTTGGTTGAAGATTGTTTTAGGTGTTGGGATTCCTG
TAGTGGTGCTTTTGATTCTTGCCGCGGCGTATTTAGGGTATTGTTATCATAAGAAAAGGA
TTGATAGGTCACAGTCTAACATATTGGGTGCACTCAAGAGCTTGCCTGGAACACCACAAG
AGTTTCAGTTTAAGGCTTTGAAGAAAGCTACAAACAATTTTGATGAAAAGAATAAGCTTG
GGCAAGGAGGATATGGAGTTGTTTACAGAGGATTTTTAGCTGGTGAGGAGAACAAAGATA
TTGCTGTCAAATGGTTTTCTAGGGAAAGCATCAAAGGGCAAGATGATTTCTTGGCTGAGC
TTACTATTATCAATCGTCTTCGACATAAACATCTTGTCAAATTGCTTGGATGGTGTCACA
AGAATGGAAAGTTACTGCTTGTATATGAATACATGCCTAATGGCAGTCTAGATATGCACC
TCTTTGCGGGACCAGATAAAGAGTCGTTGAGCTGGAACGTCCGCTACAAGATTGTTCAAG
GTGTTGCCTCAGCATTGCACTATCTGCACAATGAGTATGAGCAGAGGGTGGTCCATCGCG
ACCTGAAGGCGAGTAACATCATGCTTGACTCAAAGTTCAATGCGCGCCTTGGGGACTTTG
GCCTTGCACGGGCACTTGACAACGAAAGGACCTCGTATGCTGAGGCAGAAGGAGTGCTTG
GCACAATGGGATACATTGCACCAGAGTGTTTCCACACAGGGAAAGCCACACAGCAATCTG
ATGTATACGCGTTTGGGGCAGTGTTGTTGGAAGTTGTATGTGGCCAGAGACCTGGAACCA
AGATTAATGGCTTTCAATTCTTTGTTGATTGGGTTTGGTACTTGCACCGCGATGGCCGTA
TCTTGGAAGCTGTTGATCCAAGGCTTGGAGGTGACTATGTTGCTGATGAAGCAAAGAAAC
TTCTACTGCTTGGTTTGGCTTGTGCACATCCTATAGCTATTGACAGGCCTAAAACACAGG
CAATAGTTCAGATTATATCAGGGTCAGCACCAGCACCAGAAGTTCCACCATTCAAGCCAG
CATTTGTGTGGCCATCAATGATGCCAATTGACATAGACTCAAGTGTTATGGACACAACAT
CCATTACTACTTCTCACTTCAATTCAGGATGGAGTCTTGACTATCAAAGCAGGGAGACCC
CAACATATGCAGACCACTCTTTGGTGTAGTTACTTTGATGGTAAACAACTATTACCAAAA
GGAAAAATGATTTTTTTGGCCTTCTATTTTTTAAAAAATTTCCTGTAATTATGTTTTCTT
GGGAGGAGGTTAAAAATTTCCTTCAGTTTTTTATTTTTTGTTTGATGTTTTTTTCCCTTA
TCAATTTGTTATTGGGGCATGATGAAAAGATCAGAGCAACCCGTGTACATTCATATAACT
CAGTAGTGTTACATTATGTCATATTTACTGTTTTCCTGTCTTTGTCAACCAAAATTATGT
AAAAGACACTCATGTTGAGCCAAATTGGAGGAGACAGAAAATGAATAGTGGCGAAGTATC
TTTGTTGCCTCAATTGTACTACTACATACAACTTAAAGAATTCCAAGATCTCAAATTGTA
ATGAAAGATAAGAACTGATCAATTCTTATAAAAGCAATAGATAACAGAAGAACACAATAC
AAAGATGGATCATAGATGCTTTGTTGATATGCATAAATGCTCTGCCATTTTATAGGCTAT
TGTAGTATTAGATCGTTGACAATATATAGTAGATGAAATCCCACTAAGATTTATCTACTG
TCAAGATCATTTCTGTAAATCAATATAACGGAGAACCTGAGATGCTTGCCAAAGTTTTAC
AAGTTAGTGCGCATAAGATCAAGAGTTTCCCCCGCCTTTAACTTTGTTGATAAACGGAGC
TTCCTATAATCATTGAAAGTGAAAGGAACATAGATACGGGGGTGTTCAGCATCCACCAGC
TCAGGTGGTGGTTCCACTGCTGTGTCCCTTGGTCCCAAGAGGAATGAAGCAATAGACACC
CGTACTTTTGCTTCCTTGCATATCACTCTATGCTTGACAGTGTGTAATCTTCCATTGCTC
CATACCTTCACATAGGCCATAGCAAAAAGCAAGTATCATTGTCTAGTTCTTTTTTCGGAA
TCTTAGAAGGGTTAAGGGAGTAGGAATTATCTAACTTCCTGCTAAACAATCCCCGCCAGA
GGCTAGCATAAGATTGTTGGAACACGTCAAATCTTGAAAATGAACTAGGTAGAGTAGCAG
CATAGTTACCGTGCCCATGTCTCCAAGATTCACCAGGAGGGTGTTTGGCCAAGGATCAAC
TGCTACAAATTCACCAGACTTCTTCATGACCTCAAGACCGCCAACACTTTCATCATCCTG
TAGAATAGTAAGGAATCCTGAGTCTGTGTGTGTCTGAACCCCAGAGGAACCTACAGCTTC
TGGGGTGAAGTGGTACTTGTTAATCCTAAACTGACAAGGCCAATCCTCAAAGGAAACATT
TGGCAGTCCCAACCCTTCACTCATCTTTCGCAGAATGTCCATCATTAGTCCATTAGTTGC
TGCAGCATACGTCTTGATTGTCTCTCTGTTCACAGTAGGAATCAAACTGCTTTTAAGCAT
TCTAGTAAAGCAGTCTTTT