Microarray Probes on PGSC0003DMT400024267

Probe IDChipProbe Sequence
CUST_19080_PI426222305 JHI_St_60k_v1 CTGCATGTGTGAATTATTTTAAGATGAAATTGAATTCGCAAGTGTTCCACCCTTCATTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024267

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400024267 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G20560.1 +3 2e-159 461 261/342 (76%) DNAJ heat shock family protein | chr2:8848353-8849815 REVERSE LENGTH=337

Transcript Sequence (1611 bp)

>PGSC0003DMT400024267 1611 pgsc_dm_v3.4
GAACTGCTTCTGGAATCTTCTACAGTTTTCTCGACTCTGTTAGTTTTGCATTTTCCGGTC
TTCTCCTGCACTTTCCTTCTCTCTTTCAATTTCTTTTTTTCTCCACAAAATCATATACTG
AAGCAATCTTCAAGAACCATTTTTCTTCTTCTTTTGAAAAATCCAAATTTCTCAAAGTGA
AGAAAAGGAAGAGAAACGAAGCAGTAGAAGAGAAGATGGGGGTTGATTATTACAAAGTAT
TGGGTGTTGATAAGAACGCTACAGATGATGATTTGAAGAAAGCTTATAGAAAACTTGCCA
TGAAATGGCATCCTGATAAGAACCCACAAAACAAAAAAGAAGCTGAAGCTAAGTTCAAAC
AGATCTCTGAAGCTTATGATGTGCTTAGCGACTCCCAGAAAAAAGCTGTGTATGACCAGT
ATGGTGAAGAAGGGCTGAAGGGTGGGGTGCCACCGCCTGGAGCTGGTGGTCCCGGTGCCG
GTTCAACCTACTTTTCTACTGGGGATGGCCCTACTTCGTTCAGATTCAACAGTAGAAATG
CTGATGACATATTTGCTGAATTTTTCGGCTTTTCTACTCCATATGGACCTGGAGGGGGTA
GGGGTTCAAGGTTTGGTAATATGTTCACTGATGATATATTCGCAGCATCCTTTGCTGAAG
GAGGAGGTGGTGGTGGTGTTCCCATGCATCCATCAGTCCCAAGGAAAGAGGCTCCGGTAC
AACAGAACTTGCCTTGTAATCTTGAGGATCTCTACAAGGGTACCACCAAAAAGATGAAAA
TTTCTAGAGAAATTGCCGATTCGAGTGGCAAGAGAATTGTGCAAGAGATTCTGACAATCG
AAATTAAACCTGGTTGGAAGAAAGGTACAAAGATCACCTTCCAAGAAAAAGGGAATGAGC
AGCCAGGTGTTATACCAGCTGATCTGGTCTTCATAATAGATGAGAAACCTCATAAGGTAT
TCTCGCGTGATGGAAATGACTTGATTGTCTCTCAAAAGATTTCTTTGGCTGAAGCGTTAA
CTGGTACTACGGTCCATCTCACTACTCTGGATGGAAGGAACTTAACAATTCCAATCAACA
ACGTGATTCAACCAAATTATGAACATGTCGTCCAAGGTGAAGGCATGCCGCTTCCAAAAG
ACCCGTCAAAGAAAGGGAATTTGAGGATCAAATTTGACATCAAGTTCCCTGCTCGTCTCA
CTATGGCTCAGAAATCTGGTATCAAAGAGCTGTTGGGTTCTTGAGCTTTATGCACAGCTT
TGGTGCTGGTTTTGTTCTGTGTAAATATTTTCGTAAAACCATTTGAAGCTATGGAGTGGG
GCGTTGGTTTAGGCTCGTAGACGAGTCTCTTCCTTAGCAAAGTAGAATTTTGTTCTTGTT
TTTTATGGATATTGTTCAATGTATCCATTCAACAACAGGCAATACCTCTTCTTTTTTTGG
AATAAGTCTTCAAAATTCACAGGCCTCGCAGCTGTTGAATCATTAGTGTTTTCTTGCATT
GTCTGTTATGAATGTTTTCAGAAATAGAGAGGTTGGGTTTAAGTTAACTGCATGTGTGAA
TTATTTTAAGATGAAATTGAATTCGCAAGTGTTCCACCCTTCATTACTTTG