Microarray Probes on PGSC0003DMT400024266

Probe IDChipProbe Sequence
CUST_18892_PI426222305 JHI_St_60k_v1 TGGGGGTTTTTGTGATGATGTTATCACCGGTTTGAGAAATATCTTGATAATAATAGCAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024266

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400024266 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G20570.2 +3 1e-33 130 116/252 (46%) GBFs pro-rich region-interacting factor 1 | chr2:8855486-8857522 FORWARD LENGTH=436

Transcript Sequence (1139 bp)

>PGSC0003DMT400024266 1139 pgsc_dm_v3.4
CTTGACTTAGATTTGGTGTTAACAAAGAATTGATGAAAAATGTGCAGAAATATCGGTCCC
ATAGGAAACATTTGCTTGCAAGAGAAGCGGAGGCGGCAAGCTGGAGCCACCGGAGGCAAC
TCTATGGAGGTGCACCCGCGGTTGGAGGGGGCGGAGGAAAGAGAGAGATGAATCCGTGGC
CTGCACCAACAATTGGCTTTCCACCTCCTCCTCTTCCGCCCCCTATGGCACCTCCTATGC
CTCATCATTTTAGACCCTTACATGTATGGGGTCATCCATCTGTCGACCAATCATATATGC
ACATATGGCCTAAACATCTAGCACCTTCGCCGTCTCTACAACATCCATCACCAGCATGGG
CTCCTCCTCCTCATCTTCATCCTTCACCTCCTTCAGATCCTTCTTTTTGGCATCCACACC
ATCAACGGGTACAAAATTCTCTTACACCAGGAACTCCTTACTTTCCAGCACCCATAGCAC
CAACGAGATATCCGGCTGTTCATCATCCCGTACCGGGCATACCACCCGTATCGTCGCATG
GCATGTACAAAGTAGACCACTCTAATATTGGAGTTCGAAGTACCGCTACTCCTCCAGCAC
AATCTCTACCTAAACCTCCGTGCGACTTTCATCCTTCAAAGGAGAGCATAGATGCAGCCA
TTGGAGATGTTTTATCAAAGCCATGGCTACCACTTCCCCTCGGACTCAAACCTCCGGCCG
TCGATAGCGTGCTCGGTGAATTACAACGTCAAGGGGTACCTAAAATACCACCAACTTGTG
CATAGTCGTTTTTAATGAGGCAGCTAGCAAAACGCGGGTGGATTTTTTGGGGTTCACTTA
GGGTACGTAACTAAGTAGCCCTTCAATTCGACGACATTTCCTGCACTTATTTAGATGCAT
GAAGATGATCAATTCGATGTGGATCGTATATCATCATCAACATCATCGTCTAAATTAATG
CAGTTTTTTTTTTTACCTCAAATATATATATAAGAAAACTTTTAATTAATTTGTTCTTGT
TTTGCTATGTACAAGAACATGTTTTAACTTAACCGTTGGGGGTTTTTGTGATGATGTTAT
CACCGGTTTGAGAAATATCTTGATAATAATAGCAAGAGCTTCTTGTAATTAAACTTGTC