Microarray Probes on PGSC0003DMT400023766

Probe IDChipProbe Sequence
CUST_9180_PI426222305 JHI_St_60k_v1 ACCAAGGACCGTCAAATTAACCTTCAACTCAACTTCCCTGATGTCGGACGAGTCTTTAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023766

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023766 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G20240.1 +1 3e-157 459 229/331 (69%) Mitochondrial substrate carrier family protein | chr3:7057192-7058716 FORWARD LENGTH=348

Transcript Sequence (1865 bp)

>PGSC0003DMT400023766 1865 pgsc_dm_v3.4
GGAGAAGAAAACCCTAGTAATATCGGAAATTTGAGTCAAAAAAGAAAAATCTCCCTCCAT
CTGCCAAAGGTGTCAAGAAAAACGTTTTCTCCATTTTCCATGTTTACTCTTGTCTCACCG
GCGTTAGTCTTTAGGATTTTTGAAGTATTATTGTGAATGCGGCACACCTCAACTACTAAT
CTCTTGGTTGTTTCTATGGCTGCGGAATCCCAATCGCAGAAGAAGACTTACTGTGTCGTC
GGAGATACCATGATTATACCCAAGGACTTCGACCTCTCTCCTACCAAGGACCGTCAAATT
AACCTTCAACTCAACTTCCCTGATGTCGGACGAGTCTTTAATGATTTTATCAGGACTCGA
GAAGTTGGTGAATTTTTCAGTGGGGCTTTGGCTGGGGCGATGACCAAGGCCATTCTAGCT
CCTCTTGAAACCATCAGGACAAGAATGGTAGTCGGTGTTGGGTCCAGAAACATTGGTACA
AGTTTTGTTCAGGTTATTGAACGGCAGGGTTGGCAAGGGCTGTGGGCAGGTAACACAATT
AACATGCTACGGATAATTCCCACACAAGCAATTGAACTCGGGACATTTGAGTGTGTCAAG
CGAGCAATGACTTCGGCACAAGAGAAATGGATGGATACTGGTAGCCCCAAGCTGCAGATT
GGTAATGCTAGCCTGAGCTTTTCTCTCTCATGGCTATCGCCAGTTGCTGTTGCTGGTGCT
GCTGCTGGAATTGTAAGCACACTTGCATGTCATCCGCTGGAAGTGCTGAAGGATCGGTTG
ACGGTGAGTCCTGAGGTCTACCCCAGCCTACGCATTGCAGTTCACAAGATTTACAAGGAG
GGTGGAATCGCAGGCTTGTATGCTGGACTTGGGCCAACATTGATTGGCATGCTCCCATAT
AGCACTTGTTACTATTTCATGTACGAGACAATTAAGAAATCATATTGCCGTGCACAAAAG
AAAGAATCTCTAAGCCGTGCGGAGATGCTTCTAGTTGGAGCTTTCTCAGGTTTAACAGCT
AGCACTATTAGTTATCCATTGGAGGTGGCGAGAAAGCGGCTAATGGTGGGTGCTTTACAA
GGTAAATGTCCACCTCACATGGTCGCAGCACTTTCAGAAGTTATTAGGGAGGAGGGTTTG
TTAGGCCTTTATAGAGGCTGGGGTGCAAGTTGCCTAAAAGTAATGCCATCATCAGGCATT
ACTTGGACTTTCTATGAAGCTTGGAAAGATATATTGCTTGCTGATAGACGTCATGTGTAA
CAGCAGACAAATAGTAGCACAGGAAATGAAATCTTATTATTATGCGCTCAAGCTAGAAGC
TGGTGATGGTAAGAGTTAAACGTGGTCTCTGTCATCATGAGATTTGTTATTGATGCGCAT
CCACAAATTTTGCTTCCCATCTTCCGTGGGCACAAAGAAATTTCTTTAACATTTCTGTAA
ACGACAGAATATGCATTTATGATTATTGCAAGAATTACAAGCTTTTGCCTTGGGAATTTC
TTCAAGTACTGTTTCTCAGGGGTCATTGTTGTGTACTACTTGGTGTGACTAGATTAAACT
CTAAGCATAGCTGCAGAGGCAGTGAAGCTTTGAGAAGCAAATGGGCCAGGTTTTTTCAAT
TTTCCTACATGTTAGAAATGGGAGCAAGGGAGCTCTTGATTTCGGTGCACTGGAGTGAAC
ATGTTTTTTTATTCTTCTTTTCTGTTTTCTTTTTTTTTGCATCGCAGCCTCTGGTACGAT
ATGCTTAGGGAAAGGCGGGATACCTGCCAATTTTTGGTTGTCTGCAGATGTCACGTGTTT
GATGTTCTAAATTGCTCCCATAAGTTGCATAATGATGAAAAAAGTTCTGTTATGGTGATT
GTGAG