Microarray Probes on PGSC0003DMT400023727

Probe IDChipProbe Sequence
CUST_9178_PI426222305 JHI_St_60k_v1 ACTGTCAAGGCCGTTCGACGCAACTACTATGCAGTCAAGGAACTCATCAAAACTAGGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023727

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023727 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14310.1 +1 0.0 803 408/544 (75%) pectin methylesterase 3 | chr3:4772214-4775095 REVERSE LENGTH=592

Transcript Sequence (2124 bp)

>PGSC0003DMT400023727 2124 pgsc_dm_v3.4
AATTTTTCCACAACTCTCCTTTAAATTTCTTCATCCAAAATGACACGTGTCAAAGATTTT
TTCGCCGAAATGTTGGATTCCGGCAAACAAATTGATTTTTCTAAAAGGAAGAAAAAAATC
TACTTGGCCATTGTTGCCTCAGTCCTGCTCGTTGCAGCAGTAATTGGAATAGTCGCCGGA
GTTAAATCTCGTTCGAATAACTCCGACGATCATGCAGACATAATGGCCATATCCTCTTCA
GCTCATGCCATCGTAAAATCTGCGTGTAGCAACACTCTACACCCCGAACTGTGTTACTCT
GCAATTGTAAATGTTACTGATTTCTCAAAAAAAGTAACAAGCCAAAAAGATGTGATTGAA
TTGTCCTTGAATATCACTGTCAAGGCCGTTCGACGCAACTACTATGCAGTCAAGGAACTC
ATCAAAACTAGGAAAGGTTTAACCCCACGGGAAAAGGTTGCGCTGCATGACTGCCTGGAG
ACGATGGACGAGACACTCGACGAGCTCCACACTGCTGTAGCAGATCTGGAACTTTATCCC
AACAAAAAATCATTGAAAGAACACGCTGAAGACCTGAAAACTCTAATAAGTTCCGCAATT
ACAAACCAGGAAACTTGCCTCGACGGTTTCTCTCACGATGAGGCCGATAAAAAGGTCCGC
AAGGTTTTGCTGAAAGGCCAAAAGCACGTGGAAAAAATGTGCAGCAATGCTTTAGCTATG
ATCTGTAACATGACCAATACCGACATTGCAAATGAGATGAAATTATCGGGCAATAGGAAG
TTAGTAGAGGATAGCGGCGAGTGGCCGGAGTGGTTGTCCGCCGGCGACAGGAGATTGTTG
CAGTCGTCGACGGTGACGCCGGATGTGGTTGTGGCGGCCGACGGAAGCGGAGATTACAAA
ACGGTGTCGGAGGCGGTAGCGAAAGCGCCGGAGAAGAGTAGCAAGAGGTATGTGATTAGG
ATAAAAGCAGGTGTTTACAGGGAAAATGTGGATGTGCCGAAGAAGAAGACGAATATTATG
TTTATGGGAGATGGCAGAAGCAATACAATAATTACCGCAAGTAGGAATGTGCAAGATGGC
AGCACTACCTTCCACTCTGCTACAGTTGCCGCGGTGGGGGAAAAGTTCTTGGCCCGGGAC
ATAACCTTCCAAAACACAGCAGGAGCCTCGAAGCATCAAGCCGTGGCACTTCGCGTGGGG
TCTGATTTGTCCGCATTTTATAAATGTGACATATTAGCTTATCAGGACACCCTCTATGTC
CACTCCAATCGTCAATTCTTTGTACAATGTTTAGTTGCTGGTACCGTTGATTTTATTTTT
GGAAATGGTGCTGCTGTTTTACAAGACTGTGATATTCACGCCAGGCGTCCTGGTTCGGGC
CAAAAGAACATGGTTACTGCCCAAGGAAGAACTGACCCCAACCAGAACACTGGTATTGTT
ATCCAGAAATGTAGAATTGGTGCAACGTCTGATTTGAGACCGGTGCAGAAGAGTTTCCCT
ACGTATCTAGGAAGGCCGTGGAAAGAGTATTCGAGGACTGTGATCATGCAATCGTCGATT
ACTGACGTGATTCAGCCTGCTGGATGGCATGAATGGAATGGGAATTTTGCATTGAATACT
CTGTTTTATGGTGAGTATGCAAATACAGGGGCAGGAGCAGCGACCTCAGGAAGGGTTAAA
TGGAAAGGGCATAAGGTAATTACAAGTTCAACTGAGGCCCAAGCTTATACTCCTGGCAGT
TTCATTGCTGGAGGTAGTTGGTTGAGCTCCACTGGCTTCCCTTTTTCTCTTGGTCTTTGA
AACGTAAAATGATATTCGAGGGAGTACTATTTTGTTTCAATTACTTATTATTGGTGCCAT
TTTTCTTTAGAGAAGTGGTTAGTTTGATCAAGCCGTGGAGACCTAGGGTGCAGGGCATTG
GCATTGCCATTTGGCTGACGGCAAAAATAACAAGATTCATCCACGAATTGGAGTATTGGA
ATTGTGTTTTATCAACTTCTATTCGTGTTGACGAATTTCAGTGATGTATTGTACATGTTA
ATATTAACTATTGTGTTTATCTCAAGTGAAAAAGCAAAAGAAAAAAAAAGAGAATTTATG
CTTATACTTGGCCTATATCCTAAC