Microarray Probes on PGSC0003DMT400023604

Probe IDChipProbe Sequence
CUST_9423_PI426222305 JHI_St_60k_v1 TGTCCCATACCGTATGGGATTAAACAATGTGCTTAGTCAAAATCCTGACTTCATAAATTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023604

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023604 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G53903.1 +1 2e-11 61 31/60 (52%) Protein of unknown function (DUF581) | chr1:20132363-20132842 FORWARD LENGTH=126

Transcript Sequence (848 bp)

>PGSC0003DMT400023604 848 pgsc_dm_v3.4
CGTGTATCAAGTCAAAATGAGACAAACTATACAAATTGAAACACAAAACCAATCAACAAA
CTTAATTTCATCGATTTTCTTTATTTTGTTCGTATATCAAATTTTATTAGTGTATCAAAA
GTTAGGCCCCATCCCAATTATGTTTACCTAATGTCGGGCCTTCACCTTATATTGTTTACA
CTCTAACTGGCAAATTTTGGACGTGTGGGGGTGTTAGTGTCCCATACCGTATGGGATTAA
ACAATGTGCTTAGTCAAAATCCTGACTTCATAAATTAGTTTTTAAGATTGAATTTAGCAA
GGTTCATTTCTTTATCATGAAACGTTAATTAATAGTAATGTTTATATTAATTAATGCAGG
GGTGATCTTGGATTCTGCAGTGTGGAGTGTAGAAACAGGCAGATTTATTTGGATGAAATG
AAAGAACTTGAGACTTATACTAAAAATATGTTACGATCTTTTCGCCGATGTGGAGACGAT
AACCGCCGGCGGTGTAGTGAGGCTTCGGCTCTACTGGAGGAATACAATCAACGGCGAAAT
CCCCTAGCATATTCTAAGAAAAATACTCGACCTATATTTACATTATCATAATTCGAATTC
GTTTTGCTTTATTCCCAAATTCTTTTATTGGTTACAATAAAATTATTGAAAGAATATAGA
GCAAGTATTATTGATCTGACTATTCCATATATGTTTTGGATAAGAAATCTTTGATTAAAA
ACTAAAGAAATTTTGTTATTTTACGGTACTAGCTATTTAGTGATTTTGTTTTCGAAAATG
AGTTGACAAGCATATATTCGAGAAAAGTTATAATTAAAAGTGACAATATGAGCTGTCGAA
GATGTTGA