Microarray Probes on PGSC0003DMT400023552

Probe IDChipProbe Sequence
CUST_22213_PI426222305 JHI_St_60k_v1 CCTTCTGAAATTCAACACTTTGAAGATTTCTATTGCTCACATGAACCAAATGCATCAATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023552

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023552 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G53420.1 +3 4e-67 219 139/279 (50%) CCT motif family protein | chr5:21673683-21675469 FORWARD LENGTH=264

Transcript Sequence (1436 bp)

>PGSC0003DMT400023552 1436 pgsc_dm_v3.4
CAAAAACAGATTCTTTTTTCAACCCCTCCTTTTTACTCTCTCTCTCTCTATTTCGTTACG
GCTGTTTATGTTTCTGCTCTTTGCTACTACTGCTTTTGTTTTTTGCTCTGTTTTTGACAA
CTATAAATGCCCCTTTTCCTTCATTGAACAACCTCCTTATTCATTCAATTCACACATAAA
GGGTTTTTAAGCTTTTTTTGTTTGTCAAGAGACTCAACTGTGGAACAAAAATGTATGCTG
AGACTGGGTTAATGTACCCTTACTTTCAGACGTACCCTTCTGAAATTCAACACTTTGAAG
ATTTCTATTGCTCACATGAACCAAATGCATCAATGGGATCAACCATATCAGAGTATGACC
TCGGGGGAGAAGGGGATCTCTTTAAAGCTCCACAACCATTTCTTGAACAACCATTGATGG
GCCTTGATCCTATGACTGCTGCTATTTCTATGATATCTTGTTCGGAAGATGCCATCACCC
CCCAAGGACTCAAAGTTTTGGATCTAGAAACTTCATTTGAGAATGAACAACTCCTGAGTG
AAGTTTTCTATGAATGCAAAAAAGATCTATTTGAAAAAGATGCAATTGATATACCGCTCT
CTGAAGTCTTGGACATGAAATTTCCTATTGTGAAGGCTGATGGAAGCCTTACTGCAGATG
AAAACTTGGTTTCTGAGGGATCCTTCCAGAAAAGTATTAGTTCAGGGTGTCTAAGCTCCA
TGGAGTGGATACATGGGGCTCCAATGAGGCCAAATTTTATAGATTTTGGTGGAATGGACT
TCGGAGCTGTTTATGGTATGCGACGATCATTCAGTGAAGGAGACATAAAGACTCTGGGCA
ATGGCAACATAAATGTGATCCATTCTCCACGGGGTCAACCACAGATTTGTGGAACTTCCA
CTTCTGATGTTCGCAAGGAACAGCTCTCCAGATACAGGAATAAGAAGAACAAAAGGAATT
TTGGCAGAAAAATTAAGTATGCTTGCAGGAAGGCATTGGCTGATAGTCAACCAAGGATCC
GTGGAAGGTTTGCAAAAACTGAAGAAATGGATATATCGAAGAAGCATTAACTGTTAACTG
TGGAAGAAATATATAGTAAGGTAGTAATGGGACTGCTGATATTAGCTTTAGAATAGGATC
TGCTCAAATAAGCTGGGGATCCATCCAACATGTTGCAAGTTTGTTAAATCTTTGGGTAGT
GGCAATAATATTTGTAGATTAGATAAACCAACTAGTCTTGTATATAGTGTTTGTTAAATA
AAACTCAGTAACTTGTTATTATTAATATGCTTTCCTTTACAACTACTCTTATTAATGTTG
TAAAACTCAGCAACTCCTCCCCACCCCACAACACCACCAACAATATTTACACTCAAACTC
CAAACTAGTTGGTGTGTATTATATGAATCATCACTATTTTATTTTTTGAAAAATTG