Microarray Probes on PGSC0003DMT400023516

Probe IDChipProbe Sequence
CUST_22265_PI426222305 JHI_St_60k_v1 AAGTCATAAATTGGAATGGACAAAGAGTCTTAGGAGTTCTTGCTACTTCAAGATCCATAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023516

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023516 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G11410.1 +1 2e-38 141 80/146 (55%) protein phosphatase 2CA | chr3:3584181-3585649 REVERSE LENGTH=399

Transcript Sequence (827 bp)

>PGSC0003DMT400023516 827 pgsc_dm_v3.4
CTTTCTGTTGACTGAGTTCCTGTATGGGCGCAGCCTGACAGACCTGATGAGCTGGATAGA
ATTGAAAATTCAGGTGGGAAAGTCATAAATTGGAATGGACAAAGAGTCTTAGGAGTTCTT
GCTACTTCAAGATCCATAGGTGATATGTACCTCAAACCATATGTCATTCCAGATCCTGAA
GTCTTGGTTAGCCAAAGAAGTGATGAAGATGAATTCTTATTACTTGCAAGTGATGGTCTA
TGGGATGTCATTCCAAATGATGTTGCGTGTGACGTTACAAGAAGATGCTTGAATGGTCAA
ACGTTCAGGAGGTGTGACCAACAAACCAAATCCCATAAGAGAGATGATCAGTCAAGTGAA
GGTGTCAAAGAAAGTCTCGCAGCACGAGCAGCTTCCTTCCTTGCAGAGTTGGCAATTGCT
CGGGGTAGTAGGGATAACATCAGTGTAATTGTCGTCGATTTGAATAGATCTGTATGTTCA
TCCACTGACTGAGCATAGTTAAGCTTCCCATACAAATGATAGGCAAACAATTTTATGGAT
GTCCACCAGGTTAGCAATGTGAAGGGATCTTTCCTTTTGATTGCCTGCAGCAATACCATT
ACTTGCCTTCCTTGCTTGTTTGCGTAATTCTCCCCTTTTCTTTGTAAAGCTTATGGTTTA
TTTATAGACTATTATTGGCCTTGGTCATTCACATTTGAATGAGATTTCTAACAGATTAGT
TGGGAGAAAAAGTCTCCACAGGTTAGTTGCTGCAATGGAAGTCATTTGTGAGACGGTGGC
TTTGAAGTTTTCAACCTCCACCACCACTTTTTTTACTAACCCGATTG