Microarray Probes on PGSC0003DMT400023487

Probe IDChipProbe Sequence
CUST_22171_PI426222305 JHI_St_60k_v1 CAGCTGTTCAGTTGCGGAAGGCATATAATAGTTTCCTTTTCTGGTCATCACCTGTTTTGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023487

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023487 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G59140.1 +1 0.0 1920 983/1470 (67%) multidrug resistance-associated protein 14 | chr3:21863519-21868701 REVERSE LENGTH=1453

Transcript Sequence (4818 bp)

>PGSC0003DMT400023487 4818 pgsc_dm_v3.4
TTTCGATTGAATACAAATTAAAGTTTGAATCTTTGGTATTGGAATTTCATTTCCAGGGTT
TAAAGAGATTGGTAGAAGGAGATGGAGGACATTTGGGCTGTATTTTGTGGAAAACCGTAT
AATTTTGATTGGATGTCCGTGGCACAACCATCATCATGTATTAATCATGCATTCATAATT
TGTTGTGATGTTATACTTATGTTGTTCTTGATATTCACAATATCTTTAAAATACACCAAT
GTTCCTAGTTTTTCTAGGTTCTCATGTTTGCAGTTGACTTGTGCTATTTTTAATGGTTTC
TTGGGGATACTGTATGTGTCCATGTTCATTTGGATGTTTGAAGAACAGCTCAAGAATTCG
CGTAGCACATTACCACTTCATTGGTGGTTAGTGACTTTGTTTCATGGGGTTACATGGTTA
TCAGTAAGTTTAACTGTAAGTCTTAGGGGAAAACATATTTCAAGAACCCCTTTAAGGATT
TTGTCAATTCTTGTTTTTGTCTTTGCTGGAATTTTTGCTGGTATGTCACTTGTCGCGGTT
GTTCTTGATAAAGAGGTAACGGTCAAGATAGGTTTAGATGTTTTGTACTTTGTAGGAGCA
TGTTTAGTGTTGTTATGCACCTATAAGGGGCTGCAGCATGATGAAGAGATAGATCGAAAT
GGTCTTTATGCTCCGTTAAATGGTGGTGCCAATGGAATTAGTAAAAGTGATTCTGTTGGC
TTAGTCACTCCTTTTGCCAAGGCTGGGGCTCTTAATGTAATGTCGTTTTGGTGGATGAAT
CCACTGATGAAGAAGGGGAAACAGAAAACACTTGAGGATGAAGACATACCTGAATTGCGC
GAGTCTGATCGTGCTGAATCATGTTACTTGATGTTTTTGGAGCTACTGAACAAACAGAAG
CAAGTAGATCCCTCTTCCCAGCCGTCCATTTTGAAGACAATTGTGTTGTGTCATCGGAAG
GAGCTAATTGTGTCAGGACTCTTCGCGCTACTGAAAGTAACTACGCTGTCTGCTGGTCCT
TTACTTCTTAATGCATTCATTAAGGTTGCTGAAGGAGATGCTGCTTTTAAAAATGAAGGA
TTTTTATTGGTTATTCTGCTTTTTATATCAAAGAACTTGGAATCCTTGTCACAAAGGCAA
TGGTACTTCAGGTGCAGACTTATCGGTCTGAAAGTAAGGTCTTTACTTACAGCAGCCATT
TATAAGAAGCAAATAAGATTATCCAATGCTGCTAAGCTGATGCATTCTAGTGGTGAGATC
ATGAACTATGTAACTGTGGATGCATATCGAATTGGAGAGTTTCCTTTTTGGATGCATCAG
ACATGGACAACGAGTGTCCAGCTCTGCTTTGCACTTATCATTCTCTTTCGTGCAGTTGGA
CTCGCAACTATTGCATCCTTGGTAGTGATTGTAATCACTGTGCTGTGCAATACTCCGCTT
GCAAAGTTGCAACATAGGTTCCAGTCCAAGCTAATGGTTGCACAAGATGATCGGCTGAAA
GCTATCTCAGAGGCTCTTGTTAATATGAAAGTACTGAAACTATATGCATGGGAAACTCAT
TTTAAGAGTGTCATTGAGAATTTGAGGAAAGTAGAAGAGAAATGGTTATCAGCTGTTCAG
TTGCGGAAGGCATATAATAGTTTCCTTTTCTGGTCATCACCTGTTTTGGTCTCTGCTGCA
ACATTTGGGGCTTGTTATTTTCTAGGTGTTCCACTATACGCAAGTAACGTTTTCACCTTT
GTAGCAACTTTACGTCTGGTTCAGGATCCAATAAGAACCATTCCTGACGTTATTGGTGTG
GTGATTCAAGCCAAGGTTTCCTTTGCAAGGATCGTCAAGTTCCTTGAGGCCCCCGAGCTG
GAAAATGCAAATGTTAGGCAGAAGCACAACTTTGGATGTACAGATCATGCCATACTTATG
AAATCAGCTAATCTCTCATGGGAAGAGAATCCACCTCGACCTACTCTTAGAAACATTAAT
TTGGAGGTTAGACCCGGTGAGAAGATTGCTATATGTGGGGAGGTGGGCTCAGGAAAGTCA
ACTCTTCTGGCAGCAATTCTTGGAGAGGTTCCAAGTATTCAAGGAACTGTTAAAGTTTTT
GGAACAGTTGCCTATGTCTCTCAGTCAGCATGGATTCAGACGGGGTCAATACGAGAAAAT
ATTTTGTTTGGTTCTCCACTGGATAGCCAGAGATACCAGCAAACTTTGGAAAAATGTTCA
CTGCTAAAAGACCTTGAGTTGCTACCATATGGTGATCTCACTGAAATAGGTGAAAGAGGA
GTTAATCTTAGTGGTGGTCAAAAGCAGCGCATTCAGCTTGCTCGTGCACTGTATCAGAGT
GCTGATATATATCTGTTGGATGATCCGTTCAGTGCTGTAGATGCCCATACTGCTAGTAGC
TTATTCAATGAATACGTCATGGAAGCTCTCTCAGGGAAGACTGTCTTACTTGTGACCCAC
CAAGTTGATTTTCTTCCTGCTTTTGATATGGTTCTGTTAATGTCAGATGGAGAAATTTTA
AATGCAGCTCCTTATCATCAGTTATTGGCCTCAAGCAAAGAATTCCAGGACTTGGTTGAT
GCACACAAAGAGACCGCTGGTTCAGAAAGGGTTGCAGAGGTTAATTCTTCATCAAGGGGG
GAATCAAATACAAGAGAAATTCGTAAGACTGATACTAGTAAAACATCTGTAGCCCCTGGA
GGTGATCAGTTGATTAAGCAAGAGGAGAGAGAAGTCGGAGACACTGGATTTACGCCTTAT
GTTCAATATCTAAATCAGAACAAAGGGTACTTGTTCTTTGCCATTGCTATGCTCTCGCAC
GTAACATTTGTGATTGGTCAGATAACTCAGAACTCCTGGATGGCTGCAAATGTTGATAAT
CCCCATGTTAGCACTCTGAGACTGATTACAGTTTACTTGGTAATTGGAGTTGTTTCAACG
CTGTTTTTGCTCTCTAGATCCCTATCAACGGTTTTCTTAGGTTTGCAATCATCAAAGTCC
TTGTTCTCGGAGCTATTAAATTCTCTTTTTCGTGCTCCTATGTCATTTTATGACTCTACA
CCTTTGGGGAGGATATTAAGCCGGGTCTCATCAGATTTGAGTATAGTTGATCTTGATATT
CCATTTAACTTGGTTTTCGCTTTTGGAGCTACCACAAACTTCTATTCAAATCTTATAGTG
CTAGCTGTTGTGACTTGGCAAGTTCTGGCTATCTCCATCCCAATGGTTTATTTGGCCATT
CGGTTGCAGAAATACTACTATGCATCAGCCAAAGAGTTGATGCGGATAAATGGTACTACC
AAATCATTTGTGGCTAACCATCTTTCTGAATCTATTGCTGGAGCTGTCACTATAAGGGCA
TTCAAAGAGGAAGATAGGTTTTTCGCGAAGACTTTTGAGCTTATTGATATAAATGCCAGT
CCTTTCTTCCACAATTTTGCAGCAAACGAGTGGTTGATTCAACGACTGGAAACTATTAGT
GCAACTGTTCTTGCATCTTCGGCACTCTGCATGGTTTTGCTTCCTCCTGGAACTTTCAGC
TCAGGATTTATTGGGATGGCTTTGTCCTATGGTCTTTCCTTAAACATGTCTCTTGTTTTT
TCCATTCAAAACCAGTGCACACTCGCAAATTACATAATTTCTGTAGAAAGACTTAACCAG
TATATGCACATCCCAAGTGAAGCTCCTGAGATTGTTAAAGAGAACCGTCCACCAGTTAAT
TGGCCAACAAGGGGTAAAGTTGAAATTCAAGATTTGCAGATCAGATATAGGGAAGATTCC
CCGCTTGTTCTTAGGGGGGTCAGTTGTACATTTGAAGGAGGCCATAAAATTGGTATTGTT
GGCCGGACTGGCAGTGGCAAGACTACACTCATTGGTGCATTATTTCGATTAGTGGAGCCA
ACAAGTGGAAGGATTTTGGTAGATGGAATTGACATTTCTAAAATTGGTCTTCATGATTTA
AGGTCCCGTTTTGGGATTATACCTCAAGACCCTACACTCTTCAATGGAACAGTAAGATAC
AACTTGGATCCCTTATGTCAGCATACTGATGAGGAAATATGGGAGGTACTTGGAAAGTGT
CAGCTAAAAGAGCCAGTTGAGGAAAAAGAAAAGGGGCTCGACTCATTGGTTGTGGAAGAT
GGATCTAACTGGAGCATGGGACAAAGACAACTGTTCTGTTTGGGACGTGCTCTTTTGAGG
AAAGCTAAGATTTTGGTGCTTGACGAAGCAACTGCATCAATTGACAATGCTACTGATATG
ATATTGCAGAAAACTATCAGGACAGAATTTGCTAACAGTACTGTTATTACAGTAGCTCAT
AGGATACCCACAGTAATGGATTGTACAATGGTTCTGGCCATTAGTGATGGGAAACTAGTG
GAGTATGATGAACCAATGAAGCTGATGAAGCAAGAAAATTCACTATTCGGGCAGCTTGTA
AAGGAGTATTGGTCTCACTATGACTCGGCTGAATCTCATTGAAGCCAACTGTGGATTTGC
AACATCTTTTTTGGCCAAACACACATTGCCCTGTGTAGTTGCAACTGTTTTGGATGCCCG
AACAAGGCACCATTAGGGCAGAGCTGAGCGCGATATTGACTGTTAAAGAACTAGAGTTCC
AAATTCTATTGTGCAATTTGGATAGCTCGGTAGGTAGCTAGTGTGAACTGTACCTTATGT
GTCGGTCTTCTTGATTTTGTACCATTTTTCATCGGATGTATGCTTACAGATGTCTATCTT
CCAACAGTATAAATTAAGTTTTTACTCAAACCACACTTGCGGTGTTATTGTCAACTGATA
AGCTGTAGCAATTCTCCA