Microarray Probes on PGSC0003DMT400023467

Probe IDChipProbe Sequence
CUST_22210_PI426222305 JHI_St_60k_v1 TGGTTTTCATCTGTGAAGAAAGTTTTTAAACAGTCTCCTAAAGATTCACCAGACAAGAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023467

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023467 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G49260.3 +1 1e-53 192 212/473 (45%) IQ-domain 21 | chr3:18262755-18265859 FORWARD LENGTH=472

Transcript Sequence (1845 bp)

>PGSC0003DMT400023467 1845 pgsc_dm_v3.4
TAAACAATTGGAAAGGTACTCTTCTTGATCTGACCCCGTGAGAATGATAAATACTAACGG
CAAAATAAGCAGGTTTGCACTTACTACTCTTTTTATTATCACCAAACTATTTTTCTCCAA
TCACTTTTTCTTTCTTTCTTCTTCAGCAACTTACTTGGGAAAGTTCTGTTTTTTTTGTTG
TTGTCTTGATGGTTATGATCTGCTGAATGTGTATGTTTTTTGTGACAGAAAGGTCAATTC
TTTTGGCTGAATATGGGCAAGAAAGGAAGTGGTTGGTTTTCATCTGTGAAGAAAGTTTTT
AAACAGTCTCCTAAAGATTCACCAGACAAGAAGAAGGAAACATTAGACAGCAAATGGCAG
CAACCTGAACCTCCTGAAGTTGTGTCACTTGAACATTTTCCAGCAGGGAGTTCTCCAGAT
CTTATTAGTAATGGAGGGAGCAACGTTGATTCATCGTCTACTGTAGCTGAGGATCATAAC
CATGCCATTGCTGTTGCAGCTGCCACTGCTGCAGCCGCTGAGGCAGCTGTTGCAGCTGCT
CACGCGGCTGCCAAAGTCGTCAGATTAGCTGGTGGCTATGGCCTCCTGCAGTCTACAGAG
GAAAGGGCTGCCACGCTTATTCAGTCATACTACAGGGGATATCTGGCAAGACGAGCTTTG
CGTGCTCTGAAAGGATTGGTAAGGCTGCAAGCACTAGTGAGAGGACATAATGTGCGAAAA
CAAGCACAAATGACCATGAGATGTATGCAAGCATTAGTACGTGTTCAGGGCAGAGTACGA
GCAAGGAGGCTCCAGTTAGTCCAGGAGAGGCTCGAGAGCAAGCTAGAAGAAGCACGAAGA
CACGCTGCTGAAGAACAACAACACAAGCACACCAGCCCCATCAAGAAGTCAGGGGCAGAA
GGTTGGGATAACAGGAACCAAAGCATGGACAAAATCCAAGAAAGCAGTAGGAGAAAATTC
GATGCTGAAATGAAAAGGGAAAGAGCTCTTGCTTATGCCTTTGCCTATCAGCAAAAGCAA
CAACAACTATTGCACATTGATCCACATGGTGATGACGCTGAATTTTTTGGCAATGAGCGC
GAAAAGTCACAATGGGGTTGGAGTTGGCTGGAGCGATGGATGGCTTCACAACCATACCAA
TACTCAAGACACATTGTGCCAAGAGACAGCTCCTATGTGACACCTTCCACAACAAGTGAC
ATGTCTGAAAAGACAGTTGAAATGGACCTAATCACCGGGCCATTGGACTCGGAGACCATC
AACTCAGCCCGTCACACTTTTGATCAAGCTGAAACAAGCCCATACTCAGCCCGGAAGGTT
GGTCACTCAAAATTTGATAATGTCCCTAGCTACATGACCCCAACTAAGTCTGCAAAAGCC
AAGGTGAGAAATCAAGGCCCTGTTAAGCATCGTAGCCCACCATCGGCCCAATGGAATGCA
TCGAAAAGGAAGGGAGCACACTATGGTTTGGGCCTTGAATCAAGTTCAGGGGCAAGTACA
ACAGCAATCTATCAAGTCTCAAGAAGCCCAAGCCCAAAAACTACCGCGAATCGCAGTAGT
GGACATGCTAATAAATGGATGGCAACTTACAGTCCGGAATCAAGTGGCGATGATCGGGCT
TCACCATTAGGACCACATCCCTGGAGATATAATTTTAGTTGATTTTTTTTTTTTTGGTGG
TAAATAAAGTACTGATAAAAAATGCTGTTGCTGTGTGCTAATAGCTTATTGTTTTTTGTT
TCTGTATCCTATTTTGAAGTTAATTTGGATGGTTAAATATGTATGAAGTTTGAGTTTTTG
CAATGGATGTAATATATGATAAGTGTAATGTTGTTTGGGATTAAG