Microarray Probes on PGSC0003DMT400023321

Probe IDChipProbe Sequence
CUST_19604_PI426222305 JHI_St_60k_v1 GAAGCCTTAGTTCAGGTACGAATTTCGGTGTTTTGACCATTTTTTATTGTGAAATTTGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023321

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023321 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G47460.1 +1 3e-73 231 108/133 (81%) myb domain protein 12 | chr2:19476438-19479242 FORWARD LENGTH=371

Transcript Sequence (735 bp)

>PGSC0003DMT400023321 735 pgsc_dm_v3.4
ATGGGAAGAACACCTTGTTGTGAAAAAGTAGGTATCAAGAGAGGCAGATGGACTGCAGAA
GAAGATCAAATTCTCACTAATTATATTCTTTCTAATGGAGAAGGCTCTTGGAGGTCATTA
CCCAAAAATGCCGGATTATTGAGATGTGGAAAGAGTTGTAGACTAAGATGGATTAATTAT
TTGAGGTCTGACCTCAAGAGAGGGAACATTACTTCTCAAGAGGAAGATATAATCATAAAG
TTACATGCAACTTTGGGTAACAGGTGGTCTCTTATAGCGGGACATTTATCAGGTAGAACA
GACAATGAGATAAAAAATTATTGGAACTCTCATCTAAGTCGAAAAGTTGATAGCTTAAGG
ATACCAAGCGATGAGAAGTTGCCTAAAGCTGTAGTTGATTTGGCTAAAAAGGGTACATTG
AGGCCAATTAAACATTGTAGAAAATCATCGATTAATCGATCAAAAAATAAAAAGTCAAAC
TTATTAGAAGCTAAAGAAAATAGTACTTGTGGACCTTTGAGTGGAATTGTTCCTATGCCT
TCTACACCAAACATGGAAAAAGAAGCATTGTGTAGTGCAAATATGCCAGCTTGTGATAGT
GCCATGGAATTAATGCAAGAAGATGTAGCAAAGGTAGAGGTGCCAAATTCTTGGGCAGGG
TCTATAGAGGCCAAGGGAAGCCTTAGTTCAGGTACGAATTTCGGTGTTTTGACCATTTTT
TATTGTGAAATTTGA