Microarray Probes on PGSC0003DMT400023251

Probe IDChipProbe Sequence
CUST_19609_PI426222305 JHI_St_60k_v1 AGATTGTATGCTCAGATGTCTTATTTGGGAAGTTTGGCTTATGGAATACCCCAAATTAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400023251

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400023251 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G02660.1 +3 3e-178 536 359/581 (62%) alpha/beta-Hydrolases superfamily protein | chr1:572187-574746 REVERSE LENGTH=713

Transcript Sequence (2712 bp)

>PGSC0003DMT400023251 2712 pgsc_dm_v3.4
TTTGGAGAAAAAATATCGTTTTTTCCTTAACGTGAACAAAACCTGAAGAGTTTGTTCACC
TATTTATTTGCAAAAACTCACAAACCCAACACCTTTAAATTCTCTCAAATCTTGATTCTT
TATACAAAAAATTCAAAGATTGTTGCTTTACTTCAACAACCCATTTTCATACTTGAACTC
TTAACTTTACATATTTGATTCAATAACCCAAAAAAGAAAGGAGAATTTGTGAATAACTTT
GTAGGATTTGGAAAGGGGTTCTACAAATGGATGGTCTTTGTTTGACAGGAGGAGGGATAC
AGGGTATGGCGGGGCCTATTGCCGTTGCCGGTGGTGCCGGAGGTTTAGATGTACGATCGA
CCCAGTTTAGTACATCGGCGGTTGGACGTTCGTCGGCGTCGATGTCGGTTGAAAAGACAT
CTTCTTATAGGAATAAGTCATGGGGGTTTTCGTTTAGGTACCCACTTAGATCTTTTTGGT
CTGGAGGTAAAGGAAGGTATGATGCTATAGCGGTAGACGACGCTGTTTTGATGGAGGAGA
ATGAGGAGAAGAATGAGGATAAAAATGAGAATTGGGTATTGAAGATTTTGCATATTAGGT
CTTTGCAGAAGGAGAAGGAGGTAGGGGAAAAGGGTGGGGGTGATGAAGATCTGGTGGAGA
AGGTGGAGGGAGAAGGTGGTGATGAGATTGAAGATGATAGTGAAGGGCATAACAAGTATG
ATGATGGGGATGAAGAAGAATGTGATGTGTGTTCTGTAGATGATGATGAAAAATTCAAAT
TTGATAGAAATTCTTTTTCAAAGTTGCTTAGGAGGGTCACATTGGCTGAAGCTAGATTGT
ATGCTCAGATGTCTTATTTGGGAAGTTTGGCTTATGGAATACCCCAAATTAAGCCAGAAA
ATTTATTGAGGAATCATGGATTGCGTCTTGTTACATCTTCATGTGAGAAAAGAGAGCATG
CGTTAAAAGCTGAGAAAGAGAAGGCAGCAGCTGAAGATCAGGAGAAAAAAGAGAATGAAA
ACGCTCAAACTCAGGGAGAAGAAAGAAGCACTACAACTTCAGTAGAAGGGAATGGAGAGA
CCAGCGGGAACAGGATAAGTGCATCCACAGCTTACCATATAGCTGCCTCTGCCGCGTCTT
ATTTGCACTCTCATACAATGAGCATTCTTCCTTTTAAATCCTCCAAGACTATGCCAAATA
ATGATTCCTCTGAAACAACCGTCGGATGTGATGATAATATAGATGCAATGAACAGGGAAG
TTGCTTCTTTTATGGCAACCAGTGACTCAGTGACATCAGTAGTTGCTGCAAAGGAGGAAG
TAAAGCAGGCTGTTGCAGACGACCTAAATTCAAATCATTCTTCACCCTGTGAATGGTTCG
TTTGTGATGATGATCAGAGCTTGACAAGATTCTTTGTAATTCAGGGATCAGAGTCACTAG
CATCATGGAAGGCAAATCTACTCTTTGAACCTGTTAAATTTGAGGGTCTGGATGTGATGG
TCCACCGAGGTATTTATGAAGCTGCAAAGGGCATGTATGCACAGATGCTACCAGAAGTAC
GTTCACACCTTAAATCTCATGGTAGTCATGCCAATTTCCGTTTTACTGGGCACTCTCTTG
GTGGAAGTTTATCATTGCTCGTCAATCTCATGCTGATCATAAGGGGAGAAGTTCCCCCAT
CTTCCTTGCTTCCCGTTATAACTTTTGGCTCACCATCAATAATGTGTGGAGGAGACCGCC
TCCTTCGCCTCCTTGGCTTGCCTCGTAGTCATGTGCAGGCAATCACAATGCACCGAGACA
TTGTACCCCGAGCCTTCTCTTGCAATTATCCCAATCACGTAGCAGAGTTTCTTAAAGCTA
TCAATGGAAACTTCCGCAATCATCAATGTCTGAATAACCAGAAGTTATTGTTTGCTCCAA
TGGGTGAATTCTTAATTCTGCAGCCAGATGACAAGTTTTCTCCAAACCATGACCTACTAC
CTTCAGGTTCCGGTCTGTATTTACTGAACTGTCCTGTATCAGATTCAACAGAGGCAGAAA
AACAACTTCAAGCCGCTCAGTTTGTGTTTTTAAACTCACCCCATCCACTCGAGATCCTAA
GTGATCGCTCTGCCTATGGTTCTGGAGGAACAGTACAAAGAGACCACGACATGAGCTCAT
ACTTAAAATCAGTTAGAAACGTAATTCGTCATGAGCTGAACAACATCAGAAAAGCTAAGA
GGAAGCAAAGGCGCAGAGTTTGGTGGCCATTGGTTTCACCAAGTGGGGTTAATGCTGGTA
TTGTTGTTAGAAGGTACGTTGAATCAGGTAGTATGGGCCATGGCCAGGTCAACTTTGCTG
GCATCTTACAAAGTGGGAAAGAGTCGTTGAAACGATTCAGTACACTAGTTGCATCACAGC
ACATGCACTTGCTTGTGGTGCTTTTGTTTCCTGCACGGTTACTTATTGTGGGGACTTTCA
GCATGTTCAATTTTCGTTGAATCCCCAGAAGCATTACACATTACACAAGTTAAGAAGGGT
AGATGATTCTTTATTCATTGACTACTACTGTTCCCTGGTTTTCTCAAAAGGGAACTTCCT
GGATGAATGAAATCCAAATAGATTTACAATTTGGATCCATTTGTCAATTGATAAATTCCA
TTTATGGAATGAAAAGATGTATACTTTTGTAGTACAATGTTTTGTGTAGTAATGATATAT
AGTCTCTTCTTC