Microarray Probes on PGSC0003DMT400022365

Probe IDChipProbe Sequence
CUST_50593_PI426222305 JHI_St_60k_v1 ATAAGGATCATGACATAGTACTCTGCAAAGTGTATAGAAAGGCAACCTCCTTTAAAGTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400022365

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400022365 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G17040.1 +2 3e-75 236 109/163 (67%) NAC domain containing protein 36 | chr2:7407123-7408120 FORWARD LENGTH=276

Transcript Sequence (984 bp)

>PGSC0003DMT400022365 984 pgsc_dm_v3.4
AAAATACATCCTCTAAGAAACAAAAAATAAAAAAATGTCATTAACAGAGCTTGAACTTCC
TGGGTTCCGTTTTCATCCCACTGAAGAAGAACTTATCAATTTTTACCTCAAAAGAATTAT
CAATGATGATAAAATCGATTCTAATACCATTGGTTTTCTCAACATATATCTCTATGATCC
TTGGGAGTTACCTGGGATGGCAAGAATAGGGGAAAGAGAGTGGTATTTTTTTGTACCAAT
AAACAGGAAACATGGTCCTAAAGGGAGGCCCAATAGAACAACAAGAAGTGGTTTTTGGAA
GGCAACTGGTTCTGATCGTCAAATTCGTTCTTCATTAGAACCAAAAAAAGCCATTGGTCT
TAAGAAAACTTTGGTTTTCTATGGTGGAAGGGCACCTAAAGGCACCAGAACAGATTGGGT
CATGAATGAGTACAGACTTCCTCATGGACATAAGGATCATGACATAGTACTCTGCAAAGT
GTATAGAAAGGCAACCTCCTTTAAAGTATTGGAGGAAAGGGCAATGATTGAAGAAGATGC
AGCAAAACCATATTTGGCATCAGCTGCTCCTCATGATGAATCACAGGACATGCTTGTTTC
TTTGGAATCATCATCAAAAAATGACATGTATTTCAAAAGTTGTGAAGAAGAAAATCATGA
ATTGTTAGGATCAAATGCATTTGTGGAACCACCCAAATTTAGCATTGACTCATTGTCAAG
TCCTCTTTGGAGTACAGGGCAAGACTTGTGGACTCTATTTTCTTTGTCCTGAAAATAAAA
TCACCTAGTACTATTTCAATATGGAAAACTTTAGTAATTGCATCCTCTAATGTTGGAATT
ATTGACTTTGTGGAGAATAATTGTAATCTGATAGTTTCATGTTCCCTAATTCTTTGGGTT
ATGATTGAAATCAATTGTCATACAGTCCATCCGTTAAAAAGGACCCGTTTGACCCAAAAA
TACTTGGGAAGTGGTGTTTGCCCC