Microarray Probes on PGSC0003DMT400021966

Probe IDChipProbe Sequence
CUST_36163_PI426222305 JHI_St_60k_v1 AGTTGTTGGTTGGATTTGTGTAACCGTAGCAGTGGGTGTTTTTGCAGCACCTCTTAGCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400021966

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400021966 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G13170.1 +3 2e-38 141 69/129 (53%) senescence-associated gene 29 | chr5:4181331-4183171 REVERSE LENGTH=292

Transcript Sequence (1197 bp)

>PGSC0003DMT400021966 1197 pgsc_dm_v3.4
AAACGCCTAAAATATAAGCTGATAAAAAAACGCCTCTGCCCGGGTTCGAACACGCGACCT
CGCATGTAGTAGGGCGAATTCCTGAACCCCCAACGCCACTGAGCTACGCCTTTGCTGTAT
GTTCAGGGGGTTCAATGGACCCCCAACGCCACTGAGCTACGCCTTTGCTGTATGTTAGGG
AGTTCAATAGTATATATATATACACGTATATTAAAAATTTAATCTTATATATATAGTGTA
ATTTTTCGACGAAGGGGGTTCGGATGAACCCCTTTCGTTCAACATAAATCCGCCCCTGGT
TTATTGTACCATGTTGTTCAACTTGTCAGCTTAATTCCCTTATCTTCAACAAGTGTTACA
TATATAAATTGATTGATGTTTTGAATATGCAAATTAAACAGAGGCAGACGGTGCGGCTTT
TGGTATTATTGATCGGAGGATTGTACACACTCATATTTTTAATCACTTTATTCCCTTTGA
ATGGAGTCCTACGCGTACAAGTTGTTGGTTGGATTTGTGTAACCGTAGCAGTGGGTGTTT
TTGCAGCACCTCTTAGCATCGTGTTTCAAGTGGTTCGAACAAAGAGTGTGGAATTCATGC
CTTTCACCCTCTCTTTCTTTCTTACTTTGAGTGCTATCATGTGGTTTGGTTATGGACTCC
TTCTAAAGGACTTGTGTATTGCACTGCCGAATGTGTTGGGTTTCTTTCTGGGAATGATTC
AAATGTTGTTGTATGGAATTTACCGAAACGCGAAGCCATCGGTAGATTTAGAGAAAAAAG
TGTGTGAGCTCGTAATAAACTCAGAACAGATTCATCCTCTTGATTCCGAGGACATTAATT
CCAACGATGAACAAGGAATTAACACGCCCGGAGTAGTCCCAGTATCGATGGCAAACAACA
ATGAGAATGAGGAGCGACTTGGCGAGCAACTAGCACAAGTGAACTTGCAGCCCCTTCAAA
CACCGGTGCTTGTGGTGTGTGCTGCATGAATTTTACTCTTTTATTATCTTTTAACAGTTT
ATCTGCTTCTACGTTTCATTGCTTTTTTTGTTTATTTATTTGTAATTTATAGTATTATAT
ATTACCTACCTACCTACCACTTTCGGTTTCCATTTCTCTGTGTAAAGAGGAAAAGAGAAA
TATTATGAATCAAAAGGCCGTTAAATATGTATTATTTACATTTCAATCCACGATTTC