Microarray Probes on PGSC0003DMT400021824

Probe IDChipProbe Sequence
CUST_1693_PI426222305 JHI_St_60k_v1 GCCTTATCTTGGGTTGGCCAAGAAAGTATATTATCTGTATTCTGGATTCTGAAATGATTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400021824

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400021824 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc06g051400.2 +3 0.0 861 417/436 (96%) genomic_reference:SL2.50ch06 gene_region:31251815-31254230 transcript_region:SL2.50ch06:31251815..31254230+ go_terms:GO:0042389 functional_description:Omega-3 fatty acid desaturase (AHRD V1 **** Q7X7I9_SOLLC); contains Interpro domain(s) IPR005804 Fatty acid desaturase, type 1
TAIR PP10 AT5G05580.1 +3 0.0 668 331/438 (76%) fatty acid desaturase 8 | chr5:1664331-1666345 FORWARD LENGTH=435

Transcript Sequence (1749 bp)

>PGSC0003DMT400021824 1749 pgsc_dm_v3.4
GAAGAGATAAGAGTAACAAGAAGCACAAGTTGAGATTTCTGTAGTCTAAGGAGAGACACA
CATCTTATTACTCCTTAGCCTAAAACAAACAAAGAAATATAGTACTAGTATAATTTTAAT
TTGAAACTCTCTATATTCAGATTGCAGACTTCACCTAACCCAATATCTCTCTTTTTATTT
CTCTTCTTCTCCCAAAAATGGCAAGTTGGGTTCTATCAGAATGTGGTCTTAGACCACTAC
CAAGAATATACCCAAAGCCCAGAATAGGGTTATCTTCCGTTTGCGCCACCAATTTAAATC
TGAGAAGAATTTCACCTTCACCTATACGAACAGATCGGAATTGTTGGGCATTGAGGGTAA
GTGCACCGCTTAGGATCCAAATTGCCGGAGAAGAAGAGGAACAAACAACAAACAATGGGG
ATGAGTTTTTTGACCCAGGGGCATCACCACCCTTCAGGCTTTCTGATATTAAGGCAGCTA
TTCCTAAGCATTGTTGGGTCAAAAATCCATGGACATCCATGAGTTATGTTGTTAGAGATG
TAGCTATTGTGTTTGGGTTAGCGGCTGCTGCTGCTTATTTCAACAATTGGCTTGTTTGGC
CTCTTTATTGGTTTGCTCAGAGTACAATGTTTTGGGCTCTCTTTGTTCTGGGTCATGATT
GTGGACATGGAAGCTTTTCAAATAACCATAACTTGAATAGCGTTGCTGGACATATCCTTC
ATTCTTCAATTCTTGTTCCTTATCATGGATGGAGAATAAGCCACAGAACTCATCATCAGA
ACCATGGACATGTTGAGAATGATGAATCATGGCATCCTTTATCTGAGAAGCTTTACAATA
GTTTGGATGATATCACAAAGAAATTTAGGTTCACTCTACCCTTTCCCTTGCTGGCATATC
CTTTCTATCTGTGGGGTAGAAGCCCGGGAAAGAAAGGTTCTCACTTTGATCCAAGCAGTG
ATTTGTTTGTCGCAAGTGAAAAGAAAGACGTGATCACTTCAACTGTCTGCTGGACGGCAA
TGGCTGCATTGCTTGTGGGATTGTCCTTTGTCATGGGTCCTCTCCAAGTTCTTAAGCTTT
ATGGCATCCCCTATTGGGGCTTTGTCATGTGGCTGGATATAGTTACCTATTTGCATCACC
ATGGCCATGAAGATAAAGTTCCTTGGTACAGAGGAGAGGAATGGAGTTATCTGAGAGGAG
GGCTTACAACGCTTGATCGTGACTATGGATGGATTAACAACATCCACCATGACATAGGGA
CTCATGTGATACATCATCTCTTCCCTCAAATCCCACACTATCATTTGGTAGAAGCAACGG
AAGCTGCTAAACCAGTGTTAGGGAAATATTATAAGGAGCCAAAGAAGTCAGGGCCTCTAC
CATTTTACTTGTTGGGATATCTGATAAAAAGCATGAAGGAGGATCACTTTGTGAGTGACA
CAGGGAATGTAGTATATTATCAAACTGATCCCAACCTTTATGGGTCTGAGAAATAGCAAA
ACCCTGTTAGCTGATTCTTTTTCACTAACACTATGGCCATGCCCCATCCATTCAAGTTGG
TTGTATAAGCACTACTGGTTGAGCACAAAGTAAAGTTAGCTACATGCCATTAGAAAAGAG
CAAGTTTCAATTATTGTCTTCAGGGCCTTATCTTGGGTTGGCCAAGAAAGTATATTATCT
GTATTCTGGATTCTGAAATGATTATTTACAAAAAGATACTTCAGTCCCACTATCTTTTAT
TGTTTTTTT