Microarray Probes on PGSC0003DMT400020751

Probe IDChipProbe Sequence
CUST_29163_PI426222305 JHI_St_60k_v1 ATTCTATCCATCAAAGCAGTTCAGACAGATGGAAGAAAATACCTAGTGTTTTTGCCTCTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020751

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020751 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G23000.1 +1 4e-166 499 256/335 (76%) Calcineurin-like metallo-phosphoesterase superfamily protein | chr4:12055241-12060028 FORWARD LENGTH=1015

Transcript Sequence (1460 bp)

>PGSC0003DMT400020751 1460 pgsc_dm_v3.4
TTCTGGTCGGATATATTATTCAGGTGCTTACATGCTTATTAACATTTGCAGATTGCATTG
GGCAATATATTGAAATTTAGGAAGAAAAACTGGCAATTTGATGTTATTGGTGGCATGATA
TATTTCATGTTGGTCTTTTCTATGTTTCCACAGTGTCAGCTAGATCACATTTTAAAGGAT
GACACCTTCTCGGGTCGCTTGGGAACCTTCTTTGGCACAGTGTGGGATTTGTTTATGTAT
ATGCTGGGATGCTCATATGTATCAGCAGCTGGTGCTATATTACTTTTAACAATTGCAATA
GTCTTTGTGCCTTCTATGGTGTCTTGGAAAAAGAGACTACTAATTGGGATTCTTCATGTG
TCCGCACACTTGGCTGCTGCCTTGATTCTCATGCTCTTGATGGAATTAGGTGTTGAAATA
TGTATTCGGCATAAATTACTTGCAACTTCAGGTTATCACACTTTATATCAATGGTACCAG
TCTGTGGAGAGTGAGCATTTTCCCGATCCAACTGGCCTTAGGGAACGTATAGAACAATGG
ACATTTGGCCTATATCCAGCATGTATCAAGTATCTCATGTCCGGTTTTGACGTTCCTGAG
GTAATGGCCGTTACCAGGAGTAATATTTGCAAAAATGGGATTGATTCTCTCTCCCGAGGG
GGTGCTGTCATATATTATGCATCAGTCTTCCTTTATTTTTGGGTCTTATCAACTCCGGTG
GTTTCTTTGATACTTGGAAGCTACCTGTACATTTCCATCAATTGGCTTCACATACATTTC
GATGAAGCATTTTCATCACTCCGCATTGCAAATTACAAGTCATTTACACGGTTCCATATC
AATACCAAAGGCGATCTTGAAGTTTTTACCCTTGCAGTCGATAAGGTTCCGAAAGAGTGG
AAATTGGATCCAAATTGGGATGGGGAGTCGAAACAGCCACAAGAACCAAGTTATCTCCAG
AAGTTCCCTAGCAAATGGAGAGCTAAGGCCCCTCAGCAGGACCCTGTAAATACCGTGCGA
ATAATTGATCATTTTGTCATCGAACAGAAAGAATAACCTGATTCAGAACTATCGAACGGG
TAACTTAACCAATGAGTAGTTTGATTACTAACTCATCTAGTGTCATCCTGTACAAATGTT
GTAGGTTTAAAGTACTTAGACAGTAGTTGATATACAAGAAGTTTTTTAGGATAGAAACAG
GATTGTAAAAGACAAATCAAAGATCCATTTGGATCATAGTTTTGTTAAGAAAAGAGAAAT
CCTTGTTAGTCATTATACTTTTCTTTTAATTGAACCACCATTCTCTTTTAGGAATATCTG
TCTATTGTCTAGTAACTTCACATTGTGAGATATTACTAGTATCTTGTGGCTGGTGAAATC
AAGAATCTAAGTACTAGGTAATTCTATCCATCAAAGCAGTTCAGACAGATGGAAGAAAAT
ACCTAGTGTTTTTGCCTCTA