Microarray Probes on PGSC0003DMT400020670

Probe IDChipProbe Sequence
CUST_29022_PI426222305 JHI_St_60k_v1 ATTTGCACCGTGATAGTAAGTGGCTTATGTTGAAGATAACTATCTTCTAGTAAAAGGGCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020670

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020670 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G45249.3 +3 7e-105 330 239/446 (54%) abscisic acid responsive elements-binding factor 2 | chr1:17165420-17167415 REVERSE LENGTH=427

Transcript Sequence (2135 bp)

>PGSC0003DMT400020670 2135 pgsc_dm_v3.4
TATTTGGGCTACCGACTTCTTTTTAAAAAAAGTCCTAATTAGCCACTTGGCACTTTCAAG
AACCACTCAAAGCCAAAGAAGAAACGTCTAGCAGTGTACAAGTGAAAGCCAAAAAAAGGA
GAAAAAGAAAAAAAAGGTTTTGTGATTCTTGAATAACAGAGGTGAGGTTTGAAGGAGGAT
TAGGTGAGGACTGAGGAGTTTTTAGTGAAATGGGGAGTAATTATCATTTCAAGAACTTTG
GTAATGAGCCACCAGGTGAGGGTGGAAGTGGTGGTGGTGGTGGTGGTGGGAAGCAGCTGG
GGAACTTTGGATTGCCGCGGCAGTCATCTATCTATTCGTTGACATTTGATGAGTTTCTTA
GCTCAACAGGAGGGAGTGGTAAGGATTTTGGGTCAATGAACATGGATGAGTTGTTAAAGA
ACATATGGAATGCTGAGGAGAATCAAACAATAGGAGGGCCTGGGATTAATGGGCAAGAGG
TTGGTGTTCCACGTGGGCATTTGCAGAGGCAAGGATCTTTGACTTTACCTAGGACACTGA
GTCATAAGACTGTAGATGAAGTTTGGAGAGATATGTCAAAGGAGCATGGTGGTGGGAAGG
ATGGAAATAGTGTTGGAGTGCCACCAAATATACCTCAGACTCAGAGGCAACAGACTTTTG
GGGAGATAACACTTGAGGAATTCCTAGTTAGAGCTGGAGTTGTCAGAGAAGATGCACTGT
TTGCTGCGAAATCGAATAATACTGGAGGAATCTTTGGTGATTTGTCCTATGCTGGGAATA
ATACAGGGCTTGCATTTGGATATCAACAAGCTAATAATAGGAACACAGGTTTAATGGCTG
GTAGTATCCCTAACAAGAATGGTGAAACTGTTATCCAGACTGCTAATTTGCCACTGAATG
TGAATGGGGTCAGATCCACACAACAACAGCTAAGACCACAGCAACTGCAACAGAACCATC
AACCACAGCAACAGCAGCCACAGCAGCAACCGATTTTCCCTAAGCAGCCTGCTTTGCCCT
ATGGTGCTCCTATGGCTATCCCAAATAGTGGGCAGTTGGGCAGTCCGGGAATGAGGGTAG
GGATGGTTGGTATCCCTGATCCAGCACTCAACTCTAATTTCATTCAAGGCACTGCTCTAA
TGGGTGGAGGAATGAATATGGTAGGTTTAGGAGCCAGTGGGGTTACTGTTGCAACAGCAT
CTCCAGGTGTTTCATCATCAGATGGACTTGGGAAAAGCAATGGAGATACACCTTCTGTAT
CTCCAGTTCCTTATGTGTTTAATGGTGGTTTAAGAGGCAGGAAATACAGTACTGTGGAGA
AGGTTGTTGAAAGGAGGCAGAGGAGAATGATAAAAAATAGAGAGTCAGCTGCTAGATCAA
GAGCTCGAAAGCAGGCCTATACTATGGAGCTAGAAGCAGAAGTCGCAAAACTAAAAGAAG
AAAACGATGAACTTCAAAAGAAACAGGAAGAAATGTTGGAAATGCAGAAGAATCAGGTTA
TGGAAATGATGAACCTTCATAAGGGAGCTAAAAGGCGATGCTTAAGACGGACACAAACTG
GTCCATGGTAAAAAGGGTTTCAGAAATTAGTGGTATTAGCCCATATTTACAGACTTATAG
TAGGTGCCCTGTACAGAAAGGGAATTATGTATTCACTGTAGATCAGAAGAGAAGAGTTGT
CTTTTTGCTGTAGGTTTTTCAGTGTGTTAATTTCTTATTCTCCCTCGATGGCATCATGCA
TAGAATAGAGCCAGAATGTAGAAATACCTAGTTGACAGCAGACACACATAAAAATACATA
TATTAATGGCTCCTTTTGTAATGTGTTCTGTACAAGTGATTTGGAATATTGTTTTGACAG
GTTCACTTTTAAGCTATGATGCTCGGATCCTCCAGAAATGACTAAGAATCCGAGAAATGT
ATCTTGAAAGTAATTATCGTAGGAGTTTATGTATTTTTAGTTAAAAGTGTTATAAGGAAA
TTCAGTATGCTGTCCAAATGTTTTTCTGAAAGGGTTTACCACACGAACAAAACTTCAAAA
TATCACCATACTTGCAAATGTGTAATTTAACACCAATTTGCACCGTGATAGTAAGTGGCT
TATGTTGAAGATAACTATCTTCTAGTAAAAGGGCA