Microarray Probes on PGSC0003DMT400020647

Probe IDChipProbe Sequence
CUST_29127_PI426222305 JHI_St_60k_v1 GTATTGGGCATCATCTATTGCTTCATAAAGTAATGAACTCCGGCGATTTTTGGTTGTTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020647

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020647 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G16150.1 +1 0.0 547 270/325 (83%) N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein | chr3:5471794-5473033 FORWARD LENGTH=325

Transcript Sequence (1214 bp)

>PGSC0003DMT400020647 1214 pgsc_dm_v3.4
GCAAAACACAATTTTACAAGCATCAAAGCAATTAACAAAATAGAGAGAGAAAAGAGGGAG
AGCAAAAAAGGAGTTTATTGTAGAAATATGGGTGGTTGGGCTATAGCGGTGCACGGTGGC
GCTGGTGTGGACCCAAATCTCCCAGCTGAACGTCAGAAACAAGCTAAAGAACTCCTTACT
CGTTGCCTTAACATTGGAATCTCCGCTCTTCGCTCTTCTCTACCTGCCATTGATGTTGTT
GAACTCGTTGTGAGAGAACTGGAAAGTGATCCTCTATTCAATTCGGGTCGTGGATCTGCA
TTAACTGCAAATGGAACAGTGGAAATGGAGGCGAGCATTATGGACGGCGACGGTAGACGA
TGCGGCGCCGTTTCTGGTATCTCCACCGTGAAAAACCCAATCTCCCTCGCTCGCCTTATC
ATGGATAAATCCCCTCATTCCTATCTCGGTTTCTCCGGCGCTGAAGAATTCGCCAAACAA
CAGGGCGTGGAGATGGTAGACAATGAATATTTCATCACCGAGGACAATGTTGGAATGCTG
AAACTAGCCAAAGAGGCTAACACCATTTTGTTCGATTACAGAATTCCATTAACTGGATTG
GATTCCTGTGCGTCATCCGTTGAAAGCCCAATTCGCATGAACGGATTACCGATAAGTGTT
TACGCGCCGGAGACGGTGGGATGTGTGGTGGTAGACGGCCAAGGTAGGTGCGCCGCCGCC
ACATCCACCGGTGGTTTAATGAACAAAATGACCGGTCGTATCGGTGACTCACCGCTGATT
GGTGCTGGGACCTACGCAGGTGAGCTTTGTGGGGTGTCATGTACAGGGGAAGGAGAAGCT
ATCATACGTGGAACCCTAGCACGTGACGTGGCAGCAGTTATGGAATATAAGGAATTGGGC
CTTCAAGAAGCAGTGGACTTTGTGATTAAGAAGAGATTGGATAAAGGGTTTGCTGGGCTT
ATTGCTGTGTCTAATAAAGGGGAAGTGGCTTATGGGTTTAATTGTAATGGAATGTTTAGA
GGATGTGCTACTGAAGATGGATTTATGGATGTTGGTATTTGGTAATAGAGAGATAGAGTT
TATTAGGATGTTATTTGCTTGATAAATAATTATGTTTGGTAATTACTAGTACCAATGTTT
TTAAGTTTAATTGTGTATTGGGCATCATCTATTGCTTCATAAAGTAATGAACTCCGGCGA
TTTTTGGTTGTTCA