Microarray Probes on PGSC0003DMT400020637

Probe IDChipProbe Sequence
CUST_29001_PI426222305 JHI_St_60k_v1 GTTGTCAGAACAATGAGGGAAATGGGATTGACTCTGCCTTTCAGTAATGAATGCAGGGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020637

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020637 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G25240.1 +2 2e-66 217 136/309 (44%) Serine protease inhibitor (SERPIN) family protein | chr2:10751872-10753134 REVERSE LENGTH=385

Transcript Sequence (1050 bp)

>PGSC0003DMT400020637 1050 pgsc_dm_v3.4
TCGATTTCTCGGTGTTGGTGACATTAACGATTTGAATTCCAAGTTTTTAAATATGACTAC
TGTTATTGAGAGTAATAGTAATGGTGGCCCTGATTTGAGTTTTCTAAATGGAATGTGGGT
CGCTCATACGCATGAAATCAGAGATTCTTTCAAACATTTAGCCACTACTCTCTATAAAAT
TGAGCCTAAAATTGTTGATTTTAAACTCAAGCAAGCGGTGGTAAAAGATGTTAATACCTG
GGCAGAGTCTGCATCGAAAGGACTTATAAAAGATATTCTAAAGCCCAACAACATCAGAGA
TACAACAAAGGTCCTTTTAGCGAATGCCCTCTACTTTAAAGGTACGTGGAATTTTGATGA
AGAACGCACCATAGACAAAGACTTTTACCTACTCAATGGTGACAAGATTTCAGTTCCCTT
CATGACTGGCTGCGACAAATTCACCTATGGATCATTTGAAGGCTATCAAGTTGCTAAAAT
TCCATATGAAATTGGAAAAAATGGCGATAACAAAGAGTTCTCGATGTCTATCTTCCTTCC
AAATGAAAAAAATGGATTGCCTAGCTTATTGGAAAAAGTGAATTCTGATCCAAAATTCTT
TACCCAAAAATTCAACCTTTGGTCTGCATCACTTGATGCATTCTACATCCCAAAGTTCAA
ATTCACATACACTGCGATGAAACAAGTTGTCAGAACAATGAGGGAAATGGGATTGACTCT
GCCTTTCAGTAATGAATGCAGGGAGATCACAGAGATCGTGAAACCGGATGGGCCATTCTT
TGTCAATGGCATAATACAAAAAGCATTTATCGAAGTAAACGAGAAGGGTACTGAGGCAGC
AGCTGTTACTGTGTTGTCCGATGATGACATGGGATGTTCGATGTATGAAGCCCCTAGGCC
AAGATTTGTAGCAGATCACCCTTTCTTGTTCATGGTTAGGGAAGAGGTTTCAAGATTGGT
GCTTTTCACTGGTGCTGTACTAAATCCATCAAATGATCATTCAGATGCTATTTCATCAAG
TGATTCTGATGATAATTAAGGAAAATAAAC