Microarray Probes on PGSC0003DMT400020635

Probe IDChipProbe Sequence
CUST_29015_PI426222305 JHI_St_60k_v1 TGTGATGAGAGGTGTTATTGCTAGAGAAGTGAGAGAATATGTTGCTTCTACGGGGTTTCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020635

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020635 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G50060.1 +2 1e-52 179 80/105 (76%) myb domain protein 77 | chr3:18558146-18559051 REVERSE LENGTH=301

Transcript Sequence (1052 bp)

>PGSC0003DMT400020635 1052 pgsc_dm_v3.4
CCACCCCCTTCACCACAGTCCAAAAAGCCTCTAATTCTACCTAAAATGGCTAAAAAATAA
AGGCATTCCCTTATGTTCATGCATTTCTGCCTCACATAAATCTCTATATATACACCCTTT
ACATCACTTAACCCCACTTAACTCACTAAACTAAACATCATTATTCATCTTCAATCTCCA
TTTTCAAATACAATAATCTATTCGTGATTATTTTCCTGAAATGGATTTTTTTAACAGATG
TTCAACTTCATCTTCTTCTTCCGAATCATCTTCATCAGAATCTTCGCTTTCGGGTAAAAA
TCCGAATAAATCTGAAAGAATAAAGGGGCCATGGAGCGCTGAAGAAGATAAGATTTTAAC
GAAACTTGTTGAGCGTTACGGAGCTCGGAATTGGTCTTTGATTAGTAAATACATAAAAGG
TAGGTCCGGCAAATCCTGCCGGCTCCGGTGGTGTAATCAGTTAAGTCCTAATGTTGAACA
CCGGCCATTTTCTCCGGCGGAGGATGAAGCTATTTTAGCTGCTCATGCTAAATATGGGAA
CCGATGGGCCACCATTGCCCGATTACTTCCGGGTCGGACTGATAATGCGGTTAAAAATCA
CTGGAATTCGACATTAAAGAGGCGTTATCAGCAATTAATTCAGCAGCAAAATCAGAACCC
GATTGTGTTTTCTGATGTGAAAATTAATGGGTCAGGATCCGGATCCGGATCTGGATTCGG
GTCGTGTATGGAGTATTTAAATGTTGATGAGAGTCCAAAAGGGAATAATAATAATAATTA
CGCTGTTACGAATAATTGTAGCGGTGAATTTGATGATCCGATGACGACTTTGTCACTTGC
GCCGCCGGGAATGGGCGGAGATGAGTTGCCGGAGAAGAAAACGGAGAGTTTTCCGGAGGG
ATTTTGGGATGTGATGAGAGGTGTTATTGCTAGAGAAGTGAGAGAATATGTTGCTTCTAC
GGGGTTTCCTAATTAAAAAACAAAAAGAAAAAAAATGTTTATTATATTAATTTGTCAATT
TTAAAGTTGGGCTTTTTAAGCTTTGATAATCA