Microarray Probes on PGSC0003DMT400020601

Probe IDChipProbe Sequence
CUST_29019_PI426222305 JHI_St_60k_v1 GTAACTACATTGATAACTTCATTCAAGACTTGCATGGGCTTCTAGTTGAAAAGACTAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020601

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020601 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G54060.1 +1 2e-126 377 190/375 (51%) UDP-glucose:flavonoid 3-o-glucosyltransferase | chr5:21936902-21938308 REVERSE LENGTH=468

Transcript Sequence (1227 bp)

>PGSC0003DMT400020601 1227 pgsc_dm_v3.4
ATGACAGAGTCCATAGAAGAGTCAAAACTGGAAATAGTGATGTTCCCATGGCTTGCTTTT
GGTCACTTAATCCCATACATGAATCTGTCAAATGAACTTGCAAAAAGAGGTCACAAAATC
TCATTCTTGTTGCCCAAAAATGCTGAAGTTAGACTTCAAAAACTCAATCTTTACCCAAAT
CTCATCACATTACATAAACTGACAATGCCTCACGTTCATGGCCTTCCATATGGAGCAGAG
ACTACAGCTGATGTTCCTGGATCCTTGGAGAGTCTATTAGCAACAGCTTTTGATGAATTG
TATGATGAAATCAAATCTTTTCTTCAAAATCTAAAACCCCATTTCGTTTTCTTTGATTTT
GCTTATTGGATTCCTGATTTAGCACTAGAAATTGGGGGTATCAAGACTCTATGTTACAAA
GTTGTTTGCCCTGCTATATCATCTATAGCATTGATTCGATCACCGGTTAAGACTACATTT
ATGGCATCAACTGCAGCTGAGCTAGTAAAGCCACCACCAGATTACCCTTCTACTACTGTG
GTGTTGCGTGAAAGTGAAGCTAAGTTGTTATCATTTCTATTTCATGAATATGGCAAGGGG
GTGACATTTTACGAACGATCCAAGAAGGGAATGACAGGATGCAACGCAATAGGTGTGAAA
ACATGTAGAGAGATTGAAGGAACCTTTTGTGACTACATAGCAACACAATTTGAAAAGCCA
GTCCTGTACACAGGGCCTGTTCTTGCTGAACCGACAAAGGGGCCTTTAGAAGAACATGGA
TTATCGGATTGGCTCGAGAAATTCGAGGCAGGATCAGTAGTGTTCTGTGCATTTAGGAGC
CAAATGATTCTTGAAAAGAAACAGTTTCAACAACTTGTTTTAGGCTTTGAACTGACTGAG
TTACCATTTCTTTTAGTTGTTAAGCCACCTGAAGGGACAAATTCAGTAGAAGAAGCCTTG
CCGGAGGGATTCAAAGAAAGGGTTCAAGAAAAAGGATTGATTCTTGATTGTTGGGTGCCA
CAATTGGAGATTTTAAGTCACAAATCAGTTGGTTGTTTTGTGACTCACTGTGGTTATGGG
TCGATGTGGGAGTCTTTGGCACTGTGTGATTGTCAATTGAATCATAAGAAATGGAAGGAA
CTTCTTTCGAGTCCTGGCTTCATGAGTAACTACATTGATAACTTCATTCAAGACTTGCAT
GGGCTTCTAGTTGAAAAGACTAGATAA