Microarray Probes on PGSC0003DMT400020589

Probe IDChipProbe Sequence
CUST_28984_PI426222305 JHI_St_60k_v1 AGTTTATATTGGGTGAGGTAAAAAGTGGTGGGTGATGTCTAAGCTGGAGAGCACAATACC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020589

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020589 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G19270.1 +1 0.0 642 311/436 (71%) cytochrome P450, family 707, subfamily A, polypeptide 4 | chr3:6673885-6676400 REVERSE LENGTH=468

Transcript Sequence (1977 bp)

>PGSC0003DMT400020589 1977 pgsc_dm_v3.4
AAAAAATCACCTCATTCAAAACAAAATTCATTTGTCCATTCTATATAACAAAAAAATAGC
AACATGGTTAATTATTTTGAAATATTTTTCTATAGCTCTATATTTCTTTTTGGTATCTTG
TCCTATTATTTTTGTTTTAGCAAAAATAACAATTCATCATCCAAGAAAAATGCTTATAAA
CTTCCTCCTGGATCAATGGGATGGCCTTATATTGGTGAAACTCTTCAACTCTACTCTCAA
GACCCTAATGCCTTCTTCATTAACAGGCAAAGAAGGTTTGGTGAAATTTTTAAGACAAAA
ATACTAGGTTGTCCATGTGTGATGTTGGCAAGTCCAGAAGCTGCTAGATTTGTACTAGTA
AACCAAGCAAATTTGTTTAAGCCAACTTATCCTAAAAGTAAAGAGAATTTAATTGGTCAA
TCTGCACTTTTTTTTCATCAAGGAGATTATCATAATCACCTTAGAAAACTTGTTCAAGCT
TCTTTAAATCCAGAATCCATTCGAAATCAAATCCCTTATATCGAAGAATTATCGATTTCT
GCATTGAATTCTTGGGTTGGAGGACATGTTGTCAACACTTATCATGAGATGAAAAAGTTT
TCATTTGAAGTAGGTATACTTGCTATATTTGGACATTTGGATGGTCATGTGAAGGAAGAA
TTGAAGAAGAATTATAGCATAGTTGATAAAGGTTATAATTCATTTCCAATAAATTTGCCA
GGGAGTCTTTACAGAAAAGCCCTTCAAGCAAGAAAGAGACTTGGGAAGATTTTAAGTGAA
ATAATAAGAGAAAGGAAGGAGAAGAAGGTACTAGAAAAAGGGTTGTTGAGTTGTTTCTTG
AATGCTAAAGAAGAAAAAGGATTATTGGTATTAAATGAAGATCAAATTGCTGATAATATA
ATTGGAGTTTTATTTGCTGCACAAGATACAACAGCAAGTGTTTTGACTTGGATTTTAAAG
TATCTTCATGATAATCCAAAGCTTCTTGAGTGTGTCAAGGCTGAACAGAAAGTGATCTGG
CAGTCAAATGAACAAGAAAATCATGGGTTGACATGGACACAAACAAGAAAGATGCCTATC
ACTAGCAAGGTTGTTTTGGAGACACTGAGAATGGCTAGCATTATATCTTTTGCATTTAGA
GAGGCAGTCGCTGATGTGGAATACAAAGGATACCTAATTCCAAAAGGATGGAAGGTAATG
CCTTTGTTCAGAAATATTCATCACAACCCAGAGTTCTTTCCTGATCCACAAAAAATTGAT
CCTTCAAGATTTGAGAATGCGCCGAAACCCAATACATTTATGCCATTTGGCAGTGGAGTA
CATGCTTGTCCAGGGAATGAACTTGCCAAGCTGGAAATTCTAATTATGACACATCATCTA
GTCACTAAATTCAGGTGGGAAGTGGTAGGATCTGGTAGTGGGATTCAATATGGACCATTC
CCAGTCCCATTGGGTGGACTAGCAGCAAGATTTTGGAAGGAATCAAACTAATGGCTCTTC
TGATTTGCATATCTCAAATGATTTCATCAATCTTATCCAAGATTGTTACTCATCATTCCC
CCCCCCCCAAAAAAATATATAGGGGATGAAAGACATCTCCATATTAGTACTTAAATATAT
TCAAGAATTTACTTAATTTTAAGTATCTTTACAGCTAGCAACATTTTGTACCATTTCAAT
TTTTTTCAAGAATTGGAATACACAAAGTGTAAAATTTGATGACTCAATTCTTTTGGTTTC
TTTAATTTAGCTTTTGTTTGACATAAAAAGCAAATATACTTTGCCCATGTGTTGGGGATT
GGCAAAAAATGGGATGTTTTTATTTAAGTATCTTGTGTATTTGCCACGTGTCTTGTTGAG
TACAAGTCCTTGTTGAAAGGTCCTTATAAAAGTGGCTATTGAGGAGCCAAGTGTTGGAGT
TTATATTGGGTGAGGTAAAAAGTGGTGGGTGATGTCTAAGCTGGAGAGCACAATACC