Microarray Probes on PGSC0003DMT400020581

Probe IDChipProbe Sequence
CUST_28998_PI426222305 JHI_St_60k_v1 GCTGTATCTTACATGCCTTGTACCATCGTTATTTGAGTGAACTCTTAAATAAGTTGTAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020581

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020581 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G42900.1 +2 1e-27 110 74/194 (38%) cold regulated gene 27 | chr5:17198366-17199712 REVERSE LENGTH=246

Transcript Sequence (1210 bp)

>PGSC0003DMT400020581 1210 pgsc_dm_v3.4
TGAGCCTCTATTTCTACCAAAAGTTCCTCCCTTTTCTTCCTCTCAATTTCATTCGCTTCT
CACAATATAAATTCCCAATTTTTTCATATAATAAATTATACTCTAACCTATAGTTTTTTT
TGTTCAAGATAAAATAATGGAAACTCTATCGGATTCGAAAGGAAAAACTTCTACTAAGAA
TTTGGGTCATAAGATTGAAGAATTTTTGACTATGGAGGATTCTCGACCGAAGAGCATGGA
ATGGACTGACAAGAAGCATAGTTTGTATCTCAAGTCTATGGAAGCATCATTTGTCGACCA
CTTATATGGCTCCTTAGATGTAGTTGGTCGCCATTCCCAAAATGATGGCTTGTCAAGGCA
TAAATCATCAAGGCAAAGGCATGCCAATCCTTCAGGCCAGTATAAGGTGTTTCAAGATGG
TTGTTGGACCAAAATTGACTTCAAGAAAGACGAGCCTCAGTTAAATAAAACAAATGAATC
CGCTGCTGTATTGGCAAGCCCTTGGATTAAGCATTACAAATCTACAGGCAGACATCAAAT
GAGAGTAAATTCAGATCTACAGGGGAACACTAACTCAGTGAAACAGAACCAATCTCCCGT
ATCTGACTTCGGTTTGTGCCATAAAGATTATGTTACAGAGGTGATGGATCAAAACTTTAT
CGATGAAGATCTTGAAGGAGGACAGTCTAGCAGCAGGGAGCATTGCACAAAACGGACAAA
AATTCAGTTAGGTGCCGGTACAAGCAGTGATCAAGTAGTTCCATTTTGCACATCCTCAAT
GACTGATAATCTTAAGGATCTTCTCGAGTCGACGGAGTAAGTCTTTGGCTCTCAGCGATG
ACTATGATGACACTAACCTCTTTAACCAAGAACGACGAATGGAATGTAAAAACAGCAGGT
GGGAACACGTCGCGTTTCAAACTATTGCTATAGGTTGATCAAGATTTTGCTACAGTTTTG
CCCGGAACTAGTCATGGTTTTAATCTCTTTATTTATCTGTATGTTGGAAATTCGAGTAGC
CATCGAACCTCTAATCCTTGTACAGATTTTGGGAAAATGTTGTCAAAAAATGCTTGCTGT
ATCTTACATGCCTTGTACCATCGTTATTTGAGTGAACTCTTAAATAAGTTGTAACTAAAA
ATTGTCAATTTTTTCGAGTGTTAGCCATCAAAAATTCGGTTGGAAATATACTATCATATC
ATGAATTGAC