Microarray Probes on PGSC0003DMT400020516

Probe IDChipProbe Sequence
CUST_28981_PI426222305 JHI_St_60k_v1 GGGTCTAATTACATAGGGTCCTTTTGGTGGTTGTTAATTAGCTTTAACTTGTTGATAAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020516

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020516 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G60060.1 +2 3e-71 237 115/212 (54%) Serine/threonine-protein kinase WNK (With No Lysine)-related | chr1:22139282-22141585 FORWARD LENGTH=386

Transcript Sequence (1810 bp)

>PGSC0003DMT400020516 1810 pgsc_dm_v3.4
ATTTTCAGCTGTCAGTTCTGTCACAAAAATGACAGTCCTTGCATCCATCACTAACAGTGT
AAGTGAGCCTATCATATCCTCTGTTAGAAAGTCAGTCTGGTGCCCGAAGTATTCCGTGTT
TATACAGAATTCAGTGAAGGACTACACCATGGTCAAAATGCATGAAGAAGTAAAGGGGAT
TCAACATATAACGCATATACTCTAATACGCATAGAACAAAATACTTATCTACACAGTGCT
ATATTTCAGCGAAAGGGTGGCCCCCCACTGGCAAGTAGTCTACTCTGATTTAAAGCATCA
ATGCTTGATTTCACAACTCAAACTCGTGACCATACGAAGACAATTTTATTGTTAACCCAA
CATAAATAGAGTAGTATAAAAAAAACAAGAAAAACAGTTGTAAGTAAGTTGTTTCACTTA
AATTCATCAATTTCCTTCACACACTCATATTAAAGGCAATAAAAATTCATCTTTTTTTCT
CTCAACAACTTTTGTGATTTGAAGTAAAACACTGTGCAGCTTTATGTTCTTTTTGTTTCT
CTAGAACAAAAAAGAAAAGAAAATGGAAGGTGGACTCCCCATGCTAAATTGTCTGTTACA
ACACACACTTAGAAGTCTCTGTACTTGCTCTGACTCTTCTTCTAATGCTTCTGAGTGGGT
CTATGCTGTTTTCTGGAGAATTGTCCCAAGAAATTATCCTCCACCTAAATGGGATCATGG
AGGAGGCTTGCTCGATCGCGCTAAAGGAAGCAAGAGAAACTGGATTCTTGTTTGGGAAGA
TGGTTTTTGTGACTTTTATGAATGTGAAAGATCGAAAAGGGAATATGTAACGATAAATTT
TGGTCCTGAAATCTTCTTCAAAATGTCTCATGAGGTTTATTCTTTTGGTGAAGGATTGGT
GGGCAAAGTTGCAGCAGATAATAGTCACAGATGGGTGTTTAAAGATGCCCCAAATGAGAA
AGATTCAAACTTTATTTGCTCATGGAATATGTCCATTGAAGCTCAACCAAGAGTCTGGGG
AGTTCAGTTTAATTCAGGCATTCAGACTATTGCTATCATATCTGTTAGGGAAGGCATAAT
TCAGCTTGGCTCATTTAATAAGGTATTTGAAGATCATAATCTAGTATTAAGCATTCAGAG
GAAATTCAGCTACCTTCAGAGCATACCGGGCATTTATGCAATTCAGAGACCTTTTTTGCC
AATCCAACATCGATATACTTACAAGCCAAACAATGTCACTCTAGTTAACGAGACGGATTA
TCAAATGGATGACAAAAACCAGCTAATTGGGTCGAAAAGAGTTCATGAGTTTCCGTTCAA
GTCTATTAACTTTGGCTATAATAGCCCACAAACCATGGCTAGTCTACCTTTGTGGTCGAT
GCCTATAGCAGCACCGTCTTGTTATGGTAATGCAGTACATGAGATGAGTTCTTTACACGA
CAGAGTTACGAAGAACACTACAAGCAAGGATGTCAAGGTTGTAGATGAATTAGGCCATTT
TAAGTTTGAGACAGCTGAGGAAAATGACCAATTTTCCTTAAACCAGAACTTAGGCCTGGA
AAATAAGGTAGTTGAGGTTGGTTTTAGACAGTTGGGAAAAGGAGGGGCTGCTCCAAATCC
AAATTAATTGCAGTTTAGTGCAAGTAACAAACTGCAATGGGGTCTAATTACATAGGGTCC
TTTTGGTGGTTGTTAATTAGCTTTAACTTGTTGATAAAGTATTGAGTAATTTGTTTGTAT
GGTATTGACATAGTAATCTTTAACAATTTGTTCTGTTCATATTATTTATTGGATATACAT
TTTCTAAGAA