Microarray Probes on PGSC0003DMT400020044

Probe IDChipProbe Sequence
CUST_15530_PI426222305 JHI_St_60k_v1 GTTTTCCACTGCTGTGTTGCTGAAAATGGTTGTAAAAAGGATTGAAGATTGATCTGAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400020044

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400020044 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G19570.1 +1 2e-90 279 175/321 (55%) cytidine deaminase 1 | chr2:8470598-8471503 REVERSE LENGTH=301

Transcript Sequence (1232 bp)

>PGSC0003DMT400020044 1232 pgsc_dm_v3.4
TTACTTCCCCCCTCCCCTCCTCATTTCAAGGAAGTGTGCCAAACATTTAGATCCTTCTCA
CCAAAAAAAAAAAAAAAGAAGGGAAAATAGAGAAAAAGGAAAGGATTTACATTAGAGAAA
GGGATAATCATGGATCAACTAAAATTTGTGGTGGAAGCCTCTGAGGCTGAGTCCATTACC
CACAAACTTGGCCTACCTTCTGTCCACCACCTCCTCCCTGTCTTGGTTCAACCCGCACAG
ACCCTTGCCCGCCCACCCATCTCCAACTACCACGTCGCCGCCGTTGGCCTCGGCTCCGAC
GGCCGTGTATTCCTCGGTGTTAACCTTGAATTTCCTGGCCTACCCCTTCATCACTCTGTT
CACGCCGAGCAGTTTCTCATCACTAACCTTGCTGTCCACCGCTGTCCCCGCCTCGTTGCA
TTCGCTGTCTCTGCCGCCCCCTGTGGCCACTGCCGACAGTTTCTTCAAGAACTCCGAAAC
CCTTCCGATCTCCAAATCCACATCACATCTCAACACCAAAACAATCCCAATGTCACATTC
GAACCTTTGCGTGAAATTCTCCCAAACCCATTTGGTCCATTCGATCTCCTTGATGACGAA
ACTCCTTTACTCCTCGAGCGACATAACAACGGTTTAATCCTGTCGTATGAGATTAATCAC
GATGGAGATCTATGCAATGGGTTCTCAGATGACGATTTGAAATCGGGAAATCTGAGTAAT
GGGTTTTATAAATTGACAGAAACAGAGAGTACCCTTTTAAGGATTGCAGCTTTGGAAGGT
GCTAACGATTCACACGCACCTTACAGTGGGTGTCCATCAGGGGTAGCAATTATGGATTAT
GAAGGGAAGATTTATAGAGGTTCTTATGTGGAATCTGCTGCTTATAATCCAAGTTTAGGG
CCGGTGCAGGCGGCATTGGTGGCTTTTGTGGCTGAAGGAGGTGGTGGGTATGAACGAATT
GTGGCGGCGGCTTTGGTGGAGAAGGAAGGCGCAAAGGTAAGGCAAGAGGACACTGCTAGG
ATCTTTCTGAAATTGGTTTCTCCTAAATGTGACTTGAAGGTTTTCCACTGCTGTGTTGCT
GAAAATGGTTGTAAAAAGGATTGAAGATTGATCTGAATTTAACCAATATTTGTTCATTCT
GCAATTGCAAGTTGTCTTGTAAAAATATCCACTTTGATTATAATCAATGAAATGAATAAA
ACATATTAATCCACCATCCTATTAGAAATCAT