Microarray Probes on PGSC0003DMT400019544

Probe IDChipProbe Sequence
CUST_30087_PI426222305 JHI_St_60k_v1 GCTAGATAATCATGGAAGGGTACCATGTAAGTTTTTGTTATCATGAACTATTGGTGTTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400019544

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400019544 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G16910.1 +2 0.0 877 412/563 (73%) acyl-activating enzyme 7 | chr3:5773231-5775411 REVERSE LENGTH=569

Transcript Sequence (2128 bp)

>PGSC0003DMT400019544 2128 pgsc_dm_v3.4
GTCTTTTCTGTCGTCAGTCATCACGCATTCACCATAGCCAACCTATCCAATTTAAAAGGA
CGAGAAATCAAACGTCGCTCATCACTACGCTACAGTCACATATATATTATTTTCAGCTTC
ATTTTTTCCTTAAATTCATCTTCTCGTAAAGTCCAAAGGGAGAGAGAGGGGAAAAATGGT
GGTGGAGAGAGATATCGACCATCTTCCAAAGAATGCGGCAAACTACACAGCTCTGACGCC
GTTATCCTTCTTGGAAAGGGCGGCGATGATTTATCCCAACAGAAAATCATTAATTCATGG
GTCTGTTGAATACACATGGCTTCAGACTTATCGCCGTTGCTGTAAACTGGCTTCTGCTCT
TACCAAACGCTCCATCACTTTCGGAAGCACGGTTGCTGTGATTGCGCCAAATGTTCCTGC
TATGTATGAAGCTCATTTTGGAATTCCAATGGCTGGAGCTGTTTTAAATGCTGTCAATGT
TCGTTTAAATGCAGACACAATTGCTTTTCTTTTGGGACATTGCTCAGCTGCAGTTGTCAT
GGTGGACCAAGAATTCTTTCCATTGGCTGAGGAAGCTTTAAAAATTTTAGAAGATAAGAG
TGAAGGAAAATCAAATCGACCACTTATTGTAGTTATTGCTGATAAAAATTGTGATCCCGC
CCCACTTCAATATGCTTTAGAGAAAGGGGCAGTTGAATATGATAATTTCTTGGAAACTGG
TGACCCAAACTTTCCATGGAAGCCACCACAGGATGAGTGGCAGAGTATTGCTCTGGGCTA
TACTTCTGGTACGACAGCTAGTCCTAAAGGAGTGGTGCTTCATCATCGTGGTGCGTATCT
TATGGCTTTAAGTAATGCCGTTGTTTGGAGTATGAAAGAGGGAGCTGTGTACCTTTGGAC
TCTACCAATGTTTCACTGCAATGGTTGGTGTTTCACTTGGACACTTGCAGCAATTTGTGG
GACCAACATATGCCTTAGACAGGTAACTGCAAAGGCTGTTTATTCCGCCATAGCTTACCT
TGGTGTAACCCATTTCTCTGCTGCACCTGTGGTGCTCAATACCATAGTTAATGCTTCAAA
AGAGGAGACCATCCTTCCCCTGCCTCGCCTAGTACATGTAAGCACTGCTGGTGCTTCTCC
TCCTCCTCCTGTTCTTGCTGCAATGACTCAACGTGGCTTCCGTGTCTTACACACTTATGG
CCTTTCTGAAACCTATGGCCCCTCCACTATATGCACATGGAAGCCTGAGTGGGATTTACT
TCCCATAGATGTTCAAGCACGTCTCAATGCACGTCAAGGTGTCAGATATGTAAGCCTGGA
GCATCTAGATGTAGTTAACCCCACGGACATGACACCTGTTCCAGCCGATGGGAAAACGAT
GGGAGAAATCGTCTTCAGGGGTAATGTTGTGATGAAAGGCTACCTGAAGAACCCGAAAGC
CAATGAAGCTGCTTTTGCAGGAGGCTGGTATCACTCTGGTGATCTTGCTGTAAAACATCC
TGATGGATATATTGAAATAAAAGACAGATCAAAAGACATCATCATATCTGGTGGTGAAAA
TATTAGTAGTGTTGAGGTCGAGAATATCCTATATCAACACCCAGCAATACTGGAGGTCTC
CGTTGTTGCAAGGCCTGATGAGCAATGGGGAGAGTCACCTTGTGCATTTGTGACATTAAA
GCCTGCTGTAAAGGAAACAGATCAGCAACAGGTTGCAGAGGATATTATGAAATTTAGTCG
ATCAAAGATGCCTAGGTACTGGGTACCAAAGTCAGTGTTTTTCGGACCATTGCCAAAGAC
AGCTACAGGAAAAATACAGAAGCACTTGTTAAGGGCAAAGGCAAAGGAGATGGGACCATT
GAAGAAGAGTAGATTGTAAATGTAACACGATTTTGTCTTTGTAATTCTAAGACGTCTGCT
GCTTTAAGTGCTCGGTCTATGCATCTCTGTGTATCATGATCTTCCTTGTAGATAAATAAG
GTTATATTTCAGATTTTTGCTAGATAATCATGGAAGGGTACCATGTAAGTTTTTGTTATC
ATGAACTATTGGTGTTCATTGTATTTTAAACTGAATGGTAACTATTGGTCTTTAGATGAT
TCGTATGGAAAATCATCTTTGATTGTTT