Microarray Probes on PGSC0003DMT400019426

Probe IDChipProbe Sequence
CUST_47888_PI426222305 JHI_St_60k_v1 GAGGCATTTCATTATCCTGGACAAGTATCTTTGTACTACCAAGAGTTCCCAATAACCTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400019426

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400019426 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G45650.1 +2 6e-180 525 290/546 (53%) nitrate excretion transporter1 | chr3:16759253-16761266 FORWARD LENGTH=558

Transcript Sequence (1811 bp)

>PGSC0003DMT400019426 1811 pgsc_dm_v3.4
CCCTTTGTGTTTTTCAACCATGGAAGCTCCAATATCAGAGGCACAATTACCTAGAAGAAC
CGGAGGCTGGATCACCTTCCCCTTCATCATAGCGAGCTCAGTAGGGTTGACCTTAGCATT
TGGAGGTTGGACAAACAATCTTATTGTGTATCTGATTAAGGAATTTGATGTGGAGAGTAT
TGATGCTGCTCAAATATCAAATTTGGTTAATGGTGCTGGAAGCTTAATTCCTGTTGTTGC
TGCAATTATTGCCGACTCATTTCTTGGTTGCTTCTCTACCATTTGGATTTCATCCATCAT
CTCATTATTGGGCACTATCCTTTTAGCTTTAACAGCTACAGTTGATTCTTTAAGGCCTAA
ACCGTGTGAAGTTGATTCAACCTCATGTACCCCTAAACCGAAAGTTCAATATGTAGTTCT
CTATGCAGCAATAGTTCTGGCTACTCTGGGTAGTGGTGGTACCCGATCAACCCTTTCGAC
GATTGGAGCGGATCAACTAGCTGATAAACCAAAAGATCAAGGAATTTTCTTCAATTGGTT
CTTCTTCTTTTGGTATTCTGCTTCTGTAGTATCGTCCACAGCTATTGTCTATGTTGAAGA
TAACGTGAGTTGGAAAGCTGGATTTTTCATTTGTGCTGCGTCCAATATTGTTGCTTTACT
CATTTTCCTAATGGGAAGTAGATTTTACACTAAATTTAAGCCAGAAGGGAGTCCATTCAC
CAGTTTGGCTCGTGTTGTTGTTGCTAGTATTACCAAAAGACAAGTTCCACTCCCATCTAC
TGCTCAGGATTTCTTCCAGGGATGTAACGTAGCACCCAAATCACTAGCTGTTGTACCTTC
CAACACCTTCAGGTTTTTGAATCGTGCTGCTATTATAAGTGAAGGTGACGTAAAATCAGA
TGGTTCAACAAGTAATCGATGGAGACTTTGTTCAGTACAACAAGTAGAAGATTTCAAAAC
CTTAATTAAAATCTTACCACTTTGGTCAAGTAGTTTTTTTCTTGGCACCACAATTGGGGT
GCAATTAAGTTTTTCAGTCCTTCAAGCCTTAGCAATGGACCGCCACATAGGACCCAATTT
CCAAATCCCAGCTGGATCCGTACTCGTTTTTGTCCTCATATCTACTGCTCTATTCCTCGC
CCTGTTCGATAGAATTGTTTTACCTACGTGGAAGAATTTGACAGGCAAATCACTTACGCC
TCTCCAGAGAATTGGGATTGGACACGTGCTCAATTTTGTGAGCATGGGTGTATCAGCCTT
AGTCGAGTCAAAGAGACTAAATGTAGCAAAATCAAATGAAGGTTCCAATATTGTGGCAAT
GTCAGTTTTATGGCTTGTGCCACAATTAGCACTTAATGGTATCGCGGAGGCATTTCATTA
TCCTGGACAAGTATCTTTGTACTACCAAGAGTTCCCAATAACCTTAAAGAACATGGCGAC
GGCGATGAATTCTATGCTTATTGGTATAGCATTTTATTTGACTACCGCTCTAATTGATGT
TGTTAGAAGGACAACTACATGGTTACCAGGTAACATAAATAATGGAAGATTGGATAATGT
GTACTGGATATTGGTTGTAGGGGGAGTAGTGAACTTTGGTTACTATGTAACATGTGCTTG
GTATTACAAGTATCAAAACCTCAACGAAGTGGATCATAATGAGACTCCTTCTGATGAGTG
ATTTGAGGATGAGATCAATTTTAATATCCTCAGACTTGTGAGTGAGCAATAATTAATTTA
TCATCAATCTGCAATTACTGAAAAAACATGTTGTAATGTCAACTTCAGACAAAGATATAT
GAAGTTTTGAA