Microarray Probes on PGSC0003DMT400018190

Probe IDChipProbe Sequence
CUST_17928_PI426222305 JHI_St_60k_v1 GCCCTGTTGAGTTGGTATTTATGCCCCCTTGTATGTGTATATATATATATATATAGCCTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400018190

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400018190 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14720.1 +1 7e-15 75 64/146 (44%) MAP kinase 19 | chr3:4946057-4948906 FORWARD LENGTH=598

Transcript Sequence (908 bp)

>PGSC0003DMT400018190 908 pgsc_dm_v3.4
GGAGCAAATAAGGATGAGGAGTGATCATATTTAAAGGTGCCCTAATGAGTATATACGGAA
TGCTGAAAGTTAGGAAGTGTTGTATGCTTGTTGGAATCGCTTTTAATGTCCTTGTCAAAT
ATTAGTGATAGTGGGTTGTGCATGTCTGTTTGTTTGATTCTTCTTTAATATTCATTTCTA
TCATTTTCAGCCAAACCTGGAAGAGTTTTAGGACCAGTTTTATCATATGATGGTGACAGA
AGCATCAAAGAAGTCACTGATGGAAGAGTATATCCCCAGAACTCTGTTGTCCAACCTCAT
GGCATGTCTCCACATTATCTGTTCAGAAGTAACTCTACACATCTAGAGAGGTGTGGGACA
GAAGCAGAGAAGGACCGCTCTCAAGTTAAACCGCAACATGGCCAGTGCATGGCTGCCAAG
TCGTCCGCTAGTATGAGTTTCGAGATGAGCACTAACCCATATTACCATACACAGGCAAGG
GTAGCACAGTTGGGAGGTCAAATCGCCATGGATGCAAAACTACTACAGGCACAAACACAG
TTTGGTGCAGTCGGTGCTGCAGCTGTTGCTGTTGCCGCTCACAGAGAGGTTGGCACTGTT
CAGTATGGTCTAACCTAGTAGATACTATTGTTTGATGGTTCTTTGAATCAAGTGAGGACA
TCCCCCTTGCAGTGAGACAGTTCAAGATGTGCATTTTCCCTCAGATCAATCAGCATGGGA
GATCTGAAGAGGGATCTGTTAACCCGGTAGATGAAAACCATTTATTAGTCGTTAGGGTCT
CTAAATAGGTATTCTTTAGGTTCAGGTTGCCCTGTTGAGTTGGTATTTATGCCCCCTTGT
ATGTGTATATATATATATATATAGCCTATGCATCATTGATATTAATGAAGAAAAAAATTG
TTCTTCTG