Microarray Probes on PGSC0003DMT400017915

Probe IDChipProbe Sequence
CUST_33248_PI426222305 JHI_St_60k_v1 GTTGTTGTAATAATGACTCTGTTCTGCAGAGGGAATTGGAATAAATAATATTGGAGCAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017915

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017915 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G01500.2 +3 2e-61 199 95/137 (69%) carbonic anhydrase 1 | chr3:194853-197873 REVERSE LENGTH=347

Transcript Sequence (742 bp)

>PGSC0003DMT400017915 742 pgsc_dm_v3.4
CATTGTAACAGCTTAGGTACTCGGGAACTGGAGCTGCCATCGAATACGCTGTTCTCGATC
TTCAGGTAGAAAATATTCTAGTCATTGGTCACAGTACCTGTGGAGGTATCAATGCCCTCA
TGAGTCTTCCACAAGATGGTTCTGAATCAACTGAATTTATTGAGAATTGGGTGAAAATTG
GATTACCTGCCAAGGCCAAGGTGCTAACTGAGCATCCAAATATAAGTTTTGAAGAACAGT
GCAAATACTGTGAGAAGGAAGCTGTGAATGTATCACTAGCCAACTTGCTGACCTATCCAT
TTGTGAGAGATGGTTTGGTGAATAAAAAATTGGCATTGAAGGGAGGTTACTATGATTTCA
TTAAAGGAGAATTTAAGCTATGGGGACTTCACTTTGGTCTTTCTCATCCTTGTTCTATCT
GAATATATTCAACTACCATCTTTCTAGTGGGAGAATAGTGACACCTCTTGCTCTTTCTTT
TTCTTCGTATTGTATTCATCTATATAGTTCAGAAAATGTCTAAATAAAATAGAGGGTGGA
TTCTCCCATTTTATGGTAGAAGACAAGTGGTGAATTGTCTTTGTAATAATGACTATGTTC
GTTGTATTTGTGACGGGGAAAAACCTCTTTATCTTTATGAGTTATAGGTAATGTTTACGT
ACGTTCTACCCATTTGGGTATGTTGTTGTAATAATGACTCTGTTCTGCAGAGGGAATTGG
AATAAATAATATTGGAGCAACT