Microarray Probes on PGSC0003DMT400017893

Probe IDChipProbe Sequence
CUST_33297_PI426222305 JHI_St_60k_v1 TTGGACCTTTTTGTGCTGTTCACGAACCGTCTAAAGAAAAACAGGAGAAACCTTCATACA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017893

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017893 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G16890.2 +3 2e-123 373 211/387 (55%) UDP-Glycosyltransferase superfamily protein | chr2:7316938-7319022 FORWARD LENGTH=478

Transcript Sequence (1531 bp)

>PGSC0003DMT400017893 1531 pgsc_dm_v3.4
GTTGGCCAAACGTCTTCTTTGAAACTCAACAACGATCCCAAATTCTCAAAAATACAAACA
AGACGAGGAGCAGAGTGCAGATAAATCAGAAATGGCTTCTCTTCCTCCTCGTACTATCCA
TGTTGCTCTGTTTCCTTTTATGGCCAAAGGCCACACAATTCCTATCTTTGACCTTGCTCG
TTTTCTTCTCTGCCGCAAAATTTCCATCACCATCTTCACCACTCCTGCTAATCGTCCATT
CTTCTCCGATTCCCTTTCCGGCACCAACATCAATATCATCGAAATCCCTTTTCCTCAAAA
CATACAAGGAGTTCCACCAGGTGTAGAGAGCTACTGATAAACTTCCATCCATGACCCTTT
TCCCTACATTTGTCAACGCCACCAAATTGATGAAACCCCATTTCGAAAAGGCCCTGGAGT
CTCTTCCTCCAGTTACTTTTATGATCACTGATGGCTTTCTCGGCTGGACTTTAGATTCAG
CAAACAAATTTGGTATTCCGAGGCTTGTTTATTACGGTATGAGCGCATTTACAACGGCCT
TGACGATTTCAGCTACTTCACTTCTTAGAACAAAATTGTCCGACGATGAGTATTTCCAAG
TTCCTGATTTCCTCTGGATTAAAATCACTAGGAATGACTTTGATTCACCCCTCAGAGATC
GTGATCCCAAAGGTCCCCATTTTGATTTTATCATGGAGTTAATTATGGCGACCTCTAAAA
GCTATGGTCAACTTGTGAACAGCTTTTACGAGCTCGAATCTGTTTATGTAGACTACTGTA
ACCGCATCTCTAGTCCTAAATCATGGTGCGTTGGACCTTTTTGTGCTGTTCACGAACCGT
CTAAAGAAAAACAGGAGAAACCTTCATACATCAAATGGCTTGATGGAATGCTAGAACAGG
GGAAGCAAGTTTTATACGTGGCATTCGGGACCCAAGCAGAGTTATCTCCTGAACAATTCA
AGGAAATCAAAATTGGGTTGGAGAAATCTGAAGTGAACTTTTTGTGGGTAGTCAGGAAAA
GTATAGATGAAGTCGACGATGGGTTTGAAAACAGAGTAAAAAACAGGGGACTGATGGTGA
CAGAGTGGGTTGATCAGAGAGAAATCTTGAGCCACGGGAGCGTTGAAGGTTTTCTAAGCC
ACTGCGGTTGGAATTCAGTGGTGGAGAGCATATGTGCGAAGGTTCCCATACTGGCATGGC
CAATGATGGCTGATCAACACCTGAATGCGAGGATGGTGGTGGAGGAAATCAAGATTGGAC
TAAGAGTCGAGACGTGTGATGGGTCAGTGAGAGGGTTCGTGAAGTGGGAAGGTCTGGAAA
AGCCGATAAGGGAGTTGATGGAAGGAGAGAAAGGAAAAGAGGGAAGGAAGAAAGTGAAAG
AGATCGGAGAGGCTGCCATTAATGCAGTAAAAGAAGGTGGATCATCATGGCAAACGTTGA
ATGAGCTTATTCATGAATTAACTGAAAGAAGACAGGTTTAAATTTACGTAGCATTATACT
ATATTTTTGGGCTGAATTATGTGTCAAAAAT