Microarray Probes on PGSC0003DMT400017870

Probe IDChipProbe Sequence
CUST_33246_PI426222305 JHI_St_60k_v1 CGGAATGAATGAGAATAGTTACTGATAGTATGAATTCTCGTTTTGCATCAGTGACCTATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017870

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017870 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G39940.1 +3 2e-164 480 268/446 (60%) FAD/NAD(P)-binding oxidoreductase family protein | chr5:15987649-15990561 FORWARD LENGTH=480

Transcript Sequence (1653 bp)

>PGSC0003DMT400017870 1653 pgsc_dm_v3.4
GTTTGCATTCCACAAAACGTTCCTAAAATTCGAACTGATGAATGTTTGAATTCTTTCATT
CAATGAATTTGCTACCGCAGCGATTCATTTTTCGTTTTGGATTTGCCTCTCAAACGTCAA
CTTTCAAAGGAAACTATCCATGCTCAATCCCTAGCCATGGAAGAAGAAAATTCAGTGCAA
CTACTCTCTCCTTAGCTACTCCAAAGTCAGGTGAAGAGCTTTTGTTAGTAGTAGGGGGCG
GAGCAGCTGGAATTTACGGTGCTATAAGGGCTAAGACTCTCGCTCCGAATCTTAAAGTTG
TTGTTATTGAAAAAGCGAGACCTTTGTCAAAGGTCAAAATTTCTGGAGGAGGTCGCTGCA
ATGTGACTAATGGGCATTGTCCTGACAACAAGATTTTGGCTGAACAGTATCCAAGGGGTC
ATAAGGAATTTAAAGGCTCCTTTTTCCATACTCATGGTCCAATGGATACAATGTCCTGGT
TCTCTGATCATGGTGTTGTGTTAAAAATAGAGGAAGACGGAAGGGTCTTTCCCGCCAGTG
ATAGTTCATCTACTATAATTGATTGTCTCATGTCTGAGGCAAAGAGGAGTGGAGTCTTGT
TGCAGACTGGAAAAGTTGTTACTAGTGCTTCTTCCACTGCTGATGGAAAGTTTGCCATTA
AGCTTGAGAAACGTAGCCTTGATTATGTGGAACATGTTGAAGCTGATTATCTACTTATTG
CTAGTGGGAGTAGTAAGCAGGTAACATTCCCAAAAGTAAAAGCAAAATTACAGTTGGAAG
GCATCCAGAAGAAAATACCACAGCTTACTCAGGTAGGACCCATGCTTGTAACCCACTGGG
GACTCAGTGGGCCTGTGGTTCTTAGGCTATCTGCTTGGGGGGCACGTTATCTATCCAGTT
CAAACTATAAGGGTACGCTTTGCGTGGATTTTACTCCTGACCTCCCTATTGAAGATCTAA
AGTCTGCACTCACTCGTCACAAGAGTCAATTTTTGAGGCAGAAGGTGCTGAATTCTTATC
CTTCTGAACTTGCGGTTGTGAAAAGATTTTGGAAGTATATATTAGATCGTGAGGGCATAT
GTGGAGACATGCTGTGGTCCTCCATTTCCAATAATTTGTTAATTTCTGTCGCTGCTTTGT
TAAAAGATTGTGCATTTAGCGTGAAGGGAAAGGGCCAGTTTAAGGATGAGTTTGTCACAG
CCGGAGGTGTTCCACTTTCAGAGATCTACCTTGATATGATGGGGAGCAGGATCCATCCGC
ATCTCTACTTTGCTGGAGAGGTAGTCAATGTTGATGGTATTACTGGTGGCTTCAATTTTC
AGAATGCTTGGACAGGGGGATACATTGCAGGAACAAGTATCGGTAACCTAGCTGTACATG
AGAGAGTATATCAGTAAGTTATGCAGTAATTTGGAGATATTGAAGAGCTGATGAAGTTTT
TTGAAGTGGCAATTCTCCTAGTTATGTCTAACTCATTTTTTTTTTTATAAAAGGGAAAAG
GCAAGTGTATCAAAAGACTTGTGTATAAGTTCAGGTAGTGAATTCTCTTCGGAATGAATG
AGAATAGTTACTGATAGTATGAATTCTCGTTTTGCATCAGTGACCTATTTTATAAGAGAT
CCTTCATTTTTATATCTATCTAAAAGATCTGCA