Microarray Probes on PGSC0003DMT400017851

Probe IDChipProbe Sequence
CUST_33335_PI426222305 JHI_St_60k_v1 CAGCTGAAAGACATTGCGGATGGGCTTAGTGATGAGGAAGCTGATGAAGAAGATTCTGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017851

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017851 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G18800.1 +1 6e-94 280 138/193 (72%) NAP1-related protein 2 | chr1:6481466-6483463 REVERSE LENGTH=256

Transcript Sequence (711 bp)

>PGSC0003DMT400017851 711 pgsc_dm_v3.4
ATGGTGATTGACAATTCCAAGAAATTGAAGACAGCAGTTGAGGAAAACGCCCAACAAATT
GATACTGGTGGTGTTTCCTCCATTGAGAAGCTTCAGGAAGTTCAAGATGAACTTGAAAAG
GTGAATGAACAAGCTAGTGAGGAGGTATTGGAAATTGAACAGAAGTATAATGAGATAAGG
AGGCCTGTTTACGAGAAACGAAATGAGCTCATTAAATCAATTCCTGACTTTTGGGTGACT
GCCTTCTTGAGTCACCCTGCACTTGGTGAGCTTTTGAATGTGGAAGATCAGAAGATCTTC
AAGTACTTAGATTCTCTTGATGTGGAGGATTTCAAGGACGTGACATCCGGCTATTCCCTT
ACTTTTATATTCAAACCAAATCCTTATTTTGAAGATACAAAACTGGTCAAGACATATACA
TTCCTTGATGAAGGATCAACAAAGATAACTGGTACAGCTATTAAGTGGAAGGAAGGCATG
GGTGCGGCTTATGGTGGTAATCCTGAGATGAAAGGGAACAAGCGGCCAGCATCAGAAGAC
AGCTTTTTTAGTTGGTTTTCTGAGACTCAGCTGAAAGACATTGCGGATGGGCTTAGTGAT
GAGGAAGCTGATGAAGAAGATTCTGATGGAGACGAGGACACGGACGAGGACGATGAAGAT
GAAGAGGATAACGACGACGATGATGATGAGGCAGATGAGGATGATGGCTGA