Microarray Probes on PGSC0003DMT400017825

Probe IDChipProbe Sequence
CUST_33329_PI426222305 JHI_St_60k_v1 TGCATTGATCCAGATATGAGAAAATCAAAGAGACTAGAGTCCCTCCAATTCTTCCTAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017825

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017825 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G14210.1 +1 0.0 751 438/772 (57%) Leucine-rich repeat protein kinase family protein | chr5:4578503-4581374 REVERSE LENGTH=775

Transcript Sequence (3406 bp)

>PGSC0003DMT400017825 3406 pgsc_dm_v3.4
TTTTGAGGACTGTGAAGTAAAAAATATTGATGAGAAGCCCATCTCTTTCTTCTGCAAGAA
CCGAACCCAACGGAAAGGTCACCATTAATGGCGGAAACCTCATGAAACTCGCGACACTAC
CTATCTTCTTCTCATTCAATGCATGTAGCATTAAATTCCTTCTTCTGTCTATAGCAACCC
AACTTCTCCATTTTTCTACATTATATATACTACTCTACTTTACTCTTCTCCACTTTTGTG
CTTCTTTTAATTTCACCTCTTAAGCCGTACAAGACCCATTTATTAGTGCTTCATTATAGA
GTTCTCTGTTCTTTTTGCTTCTTTCTCTTGACCCCCAGAGTGGGTTTTTGTTCTATTTGT
TTTCTCTTCTTCCAAAATATCTCTGCCAGGAAAAAGCAAAACATTCCTTCAATGTGCAGT
TTAGTTTGTTTGTTTGTTTTTTCTTGATGGGTCTTTGTCAAGATTTGTGTTTGGTTCAGA
ATTAGTTTAATTTTCACCCAAAAATATTCTATCCATTTGGAGTTTTCCGCAGATTTAGAC
ATAAAAAAATGCTTGACGTCTGCAAGAATTGAAGCTCAAATTGTTCCCTTCAGTTTATTC
ATAAATTTCTGTTGAGTATTTAGAGGACTGTGTTAAATGGGGTGCCTAAAGATATTTGTC
ATAGTTGTATTCATGTGGGCTTTATTGATCCCAAATTCTCATCAATTAGGGTCCTATGAA
ACTCAAATTCTTCTTCAGTTACGGAGGCACTTGGAATATCCAGTGCAGTTGGATGTTTTG
GAGAATTACAATGGGGATTTTTGCAGTTTGGGTTCAACATTGAATATGAGCATTATTTGC
GAGAATAACTCTGTTACTGAGCTCAAAATCAAGGGAGATAAGCTAGTAAAGGTCAATGAA
TTCCATGGAGTTGCAGTTCCAAACAATACCTTATCTGAACGTTTCTCCATTGATTCATTT
GTTACCACTTTGACAAGGTTAAGCAGTTTAAAAGTTCTCACTTTGGTTTCTTTGGGCATT
TGGGGACCTCTCCCTGTTAAAATTCATCGGTTGTCTTCTCTAGAAGTTCTGGATATGAGT
TCAAATTTTCTTTTTGGTAAGGTTCCATCTGAGATGTCTACAATGGTGAAGCTTCATACT
TTGACATTTGATGGCAATTTTTTCAATGAGAGTCTCCCTGAGTGGTTTGATTTGTTACCT
AATATCACTATTTTAAGCATGAAGAATAATAGGTTGAAGGGTAAATTTCCTCATTCAATT
TCTAAAATCACAGGCCTAACTGATATTATTCTGTCACATAATGCTCTTTCTGGTGAATTA
CCTGATTTAAGTGCTTTGTCCAATTTGCATTTGTTGGATTTAAGAGAAAATCATTTGGAT
TCTGAACTGCCACTGTTGCCACAAGGATTGACCACTATTCTTCTTAGTAGTAATGCTTTC
TCTGGTGAGGTCCCAGAAGAATTTGGCAAACTAAATCTACTTCAACACCTTGATCTGTCA
AATAATGCTCTTACCGGAACGCCGCCTGCTGATTTGTTCTCTTTGCCAAGTATTAGTTAC
TTGAATTTAGCGTTTAACGTTCTGAGTGGTTCACTTCCTGAACATCTCAACTGTGGGAGT
GAACTTGGTTTTGTTGATATTTCTGATAATAGACTGCTTGGTATGCTTCCTTCTTGCTTG
AACGCCAGTTCGGATAAGCGAATTGTAAAGGTCAGTGGAAACTGCTTGTTGGATACACAA
TATCAGCACTCTGAGTCCTACTGCAAACAAGCTAGTTTGGCAAAGAAACAAACCACTGGA
AAAGAGATAGCAATATTGGTAGGTGTTGTTGGGGGAATTGTAATACTTGTGGTGTTTTTG
GCTGTTGTTCTTCTCATCTTTTGTAGAAGACAACATGCACGTCACGATGTGGACCGGTAC
ATGTTTCCCAAAGTTGTGCAAGATAATGGGCAACCCAATATTTCTGCTGAGCTCCTGGCA
AATGCTAGAATCATTTCTCAAACAACAGCACTAGGATCACAAGGTGCCCCATCATATCGG
GTGTTCTCCATGGAAGAGTTGGAAGAAGCGACAGAAATTTTTGATAAATCAGCATTACTC
GGTGAAGGCTCCATTGGAAAAATTTACAAGGGAAAATTAGAGAATGGAACCTATGTTGCT
GTAAGGGAATTGACTGTTCATAGACGATGCACTAGTTGGAATTTCAAACTTCGAATGGAT
TTGCTGTCAAAGTTTCGCCATCCCCATTTAGTTAGCCTTCTGGGTCACTGCATTGATGAT
GGGGTGCAAGATGACTCAACAGTCCACAGACTTTTTCTGGTTTATGAATTTATTCCTTGT
GGAAACTTCCGTGCTCGTCTTTCAGAAACTACTCCAGGAAAAGTCCTCAACTGGTCAGAC
AGGTTGGCGGTTCTGATTGGTGTTGCCAAGGCTGTGCACTTTCTCCACACGGGTGTAATC
CCTCCTTCATTCGGCAATAGCTTGAAGACAGATAGTATATTGCTTGATGAGCATCAGATT
GCAAAACTTAGTGATTATGGAATGTCAATCCTTATAGAAGAAAGTGAAAAAGTTGAGGCA
AAAGGAGATGGCCACAACGCCTGGAACACGAGGAAGAAAGAGGATGATGTGTATAACTTT
GGTTTCATATTACTGGAGTCGCTGGTGGGTCCTTTTTTTAGTGGAAAAGGAGAAACATTT
TTGCTCAATGAAATGACATCCTTTGGTAGCCAAGATGGTAGGCGTAAAATTGTGGATCCT
GCTGTGCTAACCACTAGCTCCCAAGAATCTTTGTCAATTGTAATATCACTCACCAACAAA
TGCATCTCTCCCGAGTCACAGAGTCGCCCCTCATTTGAGGATGTCCTCTGGAACCTACAA
TATGCAGCTCAAGTCCAGGCTACAGCCGATACAGATCAAAGATCTGATGCAACTTCATTG
TCATGAGGTATTCAAGAAATTCAACTGCATCTCATCAGCAATACTTGCTCATGCCGTTGT
CTCAATTGGGATGCAGGCTGAATGCATGATGTTTGTGAAGCACAAAATGGTTGCAAACCT
CAGCCTCATGTTCAATCTTCTAGTCCTCGTTATCATTTTCTTTTGTATAAAAATGTAAAT
TTGTCGATTCTTTGGATTTTAGAATTTAGAAGTGGGTGATGTTGCAAAACAGAGACTAGT
CTTCACATGAATTTGTATTACCCTCCTTCAGAAAGGATAGAAATGAAAGTGACAGAAGGC
TTAGTAGCCGTGCAACCTCAAAAATTGCCCTTCATGCTTATGTGTAAGATAAGCATACAT
GTATATCAACATCAGACTAATAACTGATCTTCATTGCCTTGGTACTTGCATTGATCCAGA
TATGAGAAAATCAAAGAGACTAGAGTCCCTCCAATTCTTCCTAAAC