Microarray Probes on PGSC0003DMT400017698

Probe IDChipProbe Sequence
CUST_13495_PI426222305 JHI_St_60k_v1 GTCGTTTGATACGAGGGATAAAAGATAATAATTTCATGATAAAATGCAGGGTTAGGGGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017698

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017698 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G12840.1 +3 7e-35 136 84/178 (47%) nuclear factor Y, subunit A1 | chr5:4051147-4052961 REVERSE LENGTH=272

Transcript Sequence (3182 bp)

>PGSC0003DMT400017698 3182 pgsc_dm_v3.4
AATAAATTAGGCCTAGATATCTACTTCTATATATATGTAGATACAGATGTATGTATAATC
TTGAGAATCTTTAGTGAAAAAAACTTTCTTTTTAGCTTAAGCATATGTATGTAATAAATA
CAAGCTAAATTTGTGAGTTTTTCTTGAAAGGGGGTTTTCTTTAACTGCTGTCATCCCCAG
AAAAAGAAAGGCAAGTTTCTATTTTGTATTGTTGTAATTTTCAATTTTCTTGAAATTCCC
ATATTTTCTTGAAATACCTAATTGGGTTACTTTTATTTGGTATTGGATCTTTTGTCTGAC
TAATCTTGGTATTGGTAAAGTTTTTGTCTTTCTAAGGTTTGATGTGTAAAAGTTTGAGTT
TTGTGTGGAAGAAGTTTGATTAGGGGAAGTCTGGTTTATGGAAATTGGATGTGTGTTGTT
GTTTTGGTTTCTGGAGCAAAATGGTTGGCTTATGCATCCTTGGTGTTTATTTGACTATTG
GGGTTTGTTTTCTTGGTAATTTTAGTGGTGAATTGTAATGCTCAGTAAGGGTTGAATCAG
TGAGTGGTGGAATATTTGATTTGATGAATTGTAGGGATCATGTAAATCTTTGTTTTGTGT
TGGAAAATTCTGGGTTTAGGTGGTAAGTCTGCATTGCGTTGGTGATGTCTCATCTTCACT
GAGTTAGAAATATATTCATTTTTGCTTGTGTATTATCATTTGTTTGTAGAATTGAGGTTT
AGGTGTAGTAATTGGAACTGATTTTTAGTTGCAGGTAAAGTAATGAGTTTCTTAACCTCT
CAAAATTCTGTTAATGGACTGTAATACGAAATACAGTATATGACATGATTGAAACGTCGA
AGCTGATAACTACCAGAAGTACTCTGGACCCAAAGGAAAAAAGAGAAAGATGAGCTTTTC
TTTTTGTGGATCAGATATGTGCTTTTAGCTTTTCTGATGCCGTATCTGCATTATCTGGTT
CCCCTGGGATTGTGCAGTTTGTCATCTTGATTCCACTTAATTAATACCGTTCACTTACAG
TGCGGAAGATAGCTTGTCTACCAAGCCGCTCATTTGAGGAACTAGTCGCTTAAAAAAAAA
AGCAAGGAGGATTCAGATGTCACACAAGGGGAATTCCATTTTAGCGGTTCTCCGAAGCCC
TATCCCTTACGAGCGAGAAATGCTCTATTTTGTGCTCTTACCCAGGAATATATATCTTAT
TAAAAGAAAAAAATGATTCATGTGACATTGTAATGGTTAGGTATAAAAGAAGTAATTGTC
GCTTGTCATGTCAATAGACCACAGCTCTGCATACATTCCAGTTCCCTTTATGGGTTTATA
GCAGGATATAGAAGCTGTGGACAATGTACAAATTTAAGGTGAAAAAAATGGCAAAACTTG
TTTGTTGGGGATGCAGTCCTAGAGAACCTTCTTTATGCATTTGTGCATACTTGTACTTGA
TAACGCATTAGTCCCGAGATAAGTCATATCCAGTTGGCAAATGCTATAACACTTGGTTCA
TGTTGTAAAAATCTTTTATGAAAAACAAGTGCCTGAATGTAGTTGGTTGACAAGGTTTCG
AATTGCATGTAGTTGCTTGATATATTTTTCTTTAATTCTGCATGACACCAAAAGATGAAT
TTGATGTCTGTCCAAGTTGGATTGCTTCTATTATTCAACTTTGTGAGATATCAACTATTC
CTACTAACAGTCTATACTGTAAATTTTTGAGTAGATCGTAATTACTTGGGGCAAGTCTAA
TAATGCCTACTATTGCTAAACATGATGGTCGGCAGCTGGAGACTGGGCTGCGAATTACCT
CACAATCAACTACCCAAATGCAGCCATGGTGGCAGGGTTATGGTGATAATACTATGCCTT
TGGCAAGTGAGAATGCCGTTGCCCAGGGGAAGTCTGAAGGTGGCAATGAGGAAAAAGAAA
CAAAGGCGCTAGCCCTGGAATCTGGATCAGATGGAAATAATGAGCAATACAAGCAGCACC
TCAAGCATTTTGCTCCCACAACTGCTGCCATCATGGCTGAGCAGCAGAAGGAACTCACAG
GTCATTCAGCTATGTTGGCGTCATATCCATATCCAGATATGCAGTATGGCGGAATGATGA
CTTATGGGGCACCTGTACATCCTCACTTATTTGAAATTCATCATGCCCGAATGCCTTTGC
CTCTTGATATGGAAGAGGAACCTGTCTATGTGAACGCGAAACAGTACCATGGAATATTAA
GGCGAAGACAAATAAGAGCTAAAGCAGAGCTTGAAAGGAAAGCTATTAAAGCGAGAAAGC
CATATTTGCATGAATCTCGGCATCAGCACGCTATGAGAAGGGCAAGGGGATCTGGGGGCC
GCTTTCTGAATACTAAAAAGGGCAATGACATGGACTGTACACCAGAGGAGACGAAAAAAT
ATGGGGCAACCATTCCAACTCACTCTGGCAACTCGTCAGGTTCCGGGAGTTCTGATCAAG
GGGGAAAGGAAGGATCTACAGTTCAAGACATGCACAAAGGACACAGCCACAGTTTCGCAA
CTGGCAATGGCCATGGTTCATCTGTGTATTTTGCCCAGAGCACTGGAAGTGAGCAAGGGA
ATGGCCACTACGGTCGCGGAAGTTGGAACCTGCTGGTCAATCAGGCTTCTCAGGGGGCAG
CTTCCAGCAATTAAGAAGCTACACTCCACTGATGGAGGGGTCAGCCCAGCATTTTCTTGT
GCCATGGGTCCATTTCTTGCATCGTTCATGCAGGCAATGCTGAACATACATGCAAGGTGG
CATGGGGCTATGCTCAGGCAATTCATTCTTGGCTTGGTTACTTGTACTATATGAGCGTCG
ATGAGGAAGAGAATAGCATATGGCGAGTATGATACGTTACAAATTCGCCATTTATTTGTC
TTTCCTCTCACCCTGTATGTAAATAAAGAAAAATATATGTCGGAATGTAAGATTAGAAGC
AGTTTGGAATCTGATACTTCAAAGTACTGCAGCATCTTGAATGTGTTTGGCTATTTGTAG
GATGGGTTTGTAAAATTGACACACACTGAAGTTGCTTTTATGCTGTTTGCTTGATTTTCC
AATGAGGATCTGCAATCCTCTCATCCATTGAACACTTAATTCTTTATCTAGTACTCTAAT
AGGTCGTTTGATACGAGGGATAAAAGATAATAATTTCATGATAAAATGCAGGGTTAGGGG
TA