Microarray Probes on PGSC0003DMT400017667

Probe IDChipProbe Sequence
CUST_13586_PI426222305 JHI_St_60k_v1 GAGAGAAGGATATAGGGTAGTTTCCAGGATATTCTTCATTGCAGATAACATACAATTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017667

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017667 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G13700.1 +3 0.0 684 340/455 (75%) polyamine oxidase 1 | chr5:4420222-4422974 REVERSE LENGTH=472

Transcript Sequence (1922 bp)

>PGSC0003DMT400017667 1922 pgsc_dm_v3.4
ATTTGTTCTCCTATTATCATCTCTCTTCTAAAAACTCAACATTCAACACACTCTCTGCTT
CCTCTTCCATGGAAATTCCCCGTCGGTCCTCTGTAATCATCATCGGAGCCGGAATCTCAG
GATTAACGGCGGCGAAGGTGTTATCGGAGAATGGAGTGGATGATGTGGTGATATTGGAGG
CGGCTGATAAGATAGGCGGTAGGATAAGGAAAGAGGAATTCGGCGGAGTAGCGGCGGAAC
TCGGTGCCGGTTGGATCGCCGGTGTCGGCGGTAAACAATCTAATCCTGTATGGGAACTTG
CACTTCAGGCTAATCTACGAACATGCTTCTCCGATTACAGTAATGCTCGTTACAACATCT
ATGATCACAGTGGGAAGATATTTCCTAGTGGAATAGCGGCGGACTCGTATAAGAAGGCGG
TGGACTCCGCGATTCAGAAACTGAGAAGCCAAGAAGGAAATCATAATGAAAACACCGAAG
ATGCTGCTGAAACGCCGTCTACTCCAAAAACACCAATAGAACTGGCGATTGATTTTTTTC
TCCATGACTTTGAAATGGCAGAGGTTGAGCCAATATCAACATATGTAGATTTTGGTGAAA
GAGAATTTCTGGTTGCTGATGAAAGAGGATATGAACATTTGCTTTATAAAATGGCAGAAA
ATTTCCTTTTTACCTCTGAGGGTAAAATTATGGACAGCCGACTCAAGCTCAATACGGTTG
TTCGGGAAGTGCAGCACTCGAGAAACGGCGTCTTGGTGACTACAGAAGATGGTCCCCTTT
ACGAAGCCAATTATGTCATTTTGTCTGTTAGCATTGGTGTTCTCCAAAGCGACCTCATTT
CATTCTCACCCCCTTTACCTAGATGGAAGATGGAAGCCGTCAGAAACTTAGATGTGATGA
TTTATACAAAGATCTTTCTCAAGTTCCCTTATAAGTTCTGGCCTTGTGAACCTGAAAAGG
AGTTCTTTATCTATGCTCACGAGCGAAGAGGCTACTATACTTTCTGGCAGCACATGGAAA
ATGCTTATCCGGGCTCCAATATGCTGGTGGTAACCCTGACAAATGGTGAGTCAAAACGTG
TGGAAGCTCAATCTGATCAAGACACATTAAGAGAAGCAATGGAAGTGTTAAGAAACATGT
TTGGGCCTGACATTCCCAATGCCACCGACATATTAGTCCCACGTTGGTGGAATAATCGGT
TTCAGCGTGGTAGCTACAGTAATTACCCCATATATGCAAATCATCAACTCGTCCATGATA
TTAAGGAACCAGTGGGACGGATATTTTTCACAGGAGAACACACAAGTGAAAAGTTTAGTG
GCTATGTCCATGGAGGCTACCTTTCAGGTATAGACAGTAGCAATGCTTTACTTGAAAAAA
TGAGAAGGGATGATGGATGGAAGAATGAGAGTCAAGCTTTTCTGTTAGAACCATTGCTAG
CATTAACAGGATCTTTGACATTGACACAAGCTGAGACTGTATCAAGTCTCCACAAATGTG
ATATTCCGCGACAACTCTTCCTTAGTAACAGCAAATTGGCAGAGGCTATCTTATGAGACT
AAATGAACCTCTGGATATAATTTACTCTGACAGATATCCATCCAACCACTGATAAACTCG
ATTTGCTGGAGTCTGACAAAAAAGTCCTTTGTTCCATTAACAGAAAAAAGGAGCAAAGAA
ACTTGAGAGAAGGATATAGGGTAGTTTCCAGGATATTCTTCATTGCAGATAACATACAAT
TGTTATTAGGAGTAAAGTCATAGAAAGGTATCATGCAGTACTAATGATATTCAGTACATG
AAAAATAAGTAACAAGATGACTGATTATGTTCAGTTGCTTTTCAATCAATTATTATTGCC
TAATGTAATCCTCAAGTTTGTATATCAAAACATAACTTTGGTTTTTTGGTTTTCTGGTTT
TC