Microarray Probes on PGSC0003DMT400017633

Probe IDChipProbe Sequence
CUST_13458_PI426222305 JHI_St_60k_v1 AACAAAATGGCAACCACACTGTTCGGAGTCCTATAGTGACATCTACCATTATTGAGGTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017633

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017633 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G34980.1 +1 2e-59 204 120/289 (42%) subtilisin-like serine protease 2 | chr4:16656929-16659223 REVERSE LENGTH=764

Transcript Sequence (906 bp)

>PGSC0003DMT400017633 906 pgsc_dm_v3.4
ATGTTTCAAGAAACGTACATGGATGGAGAAAGGCCAGCCCCAGTTCTTGCTCGATTCTCA
GCACGAGGGCCCTCCAGCAGCTACTTGGGAATCGCAAAGCCAGATATCATGGCACCAGGG
GTACTGATTCTTGCAGCATTTCCACCTAATATCTTTTCAGAAAGTATTCAGAACATAAAA
TTATCCTCTGATTATGAACTTAAATCAGGCACATCCATGGCTGCTCCTCATGCAGCTGGA
ATTGCAGCAATGCTAAAAGGTGCACATCCTGAATGGAGTCCTTCAGCTATTCGCTCCGCC
ATGATGACCACAGCAAACCATTTGGATAGTACTCAAAAGCCTATTAGAGAGGATGATAAC
ATGATTGCGACGCCACTAGACATGGGAGCAGGTCACGTTGACCCGAACAGAGCTCTTGAT
CCCGGCCTAGTATATGAGGCTACTCCACAAGATTACATAAATCTTATATGCTCTTTGAAT
TTCACAGAAGAGCAATTCAAAACATTTGCAAGATCATCAGCCAATTACGACAACTGCTCA
AATCCATCAGCTGATCTCAACTACCCATCATTCATCGCCTTGTACCCGTTCAGCCTGGAG
GGGAACTTCACCTGGTTGGAGCAGAAATTCAGGAGGACCCTTACAAATGTTGGTAAAGGT
GGAGCAACTTATAAAGTGAAGATAGAAACTCCGAAGAATTCCACAGTTTCAGTGTCTCCA
CGAACTCTAGTGTTCAAGGAGAAAAATGATAAGCAAAGTTATAATTTGACAATTCGATAT
ATAGGTGATAGTGATCAGAGTAGAAACTTTGGGTCGATCACTTGGATTGAACAAAATGGC
AACCACACTGTTCGGAGTCCTATAGTGACATCTACCATTATTGAGGTCTGGGGTAGCGAA
GACTAA