Microarray Probes on PGSC0003DMT400017573

Probe IDChipProbe Sequence
CUST_13564_PI426222305 JHI_St_60k_v1 CTGGAAATTCTACTCTTTGACCTGTTATTGCAACCTTAATTTTAGTTTGCAGAGAAGTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017573

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017573 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G63940.1 +3 0.0 609 341/674 (51%) Protein kinase protein with adenine nucleotide alpha hydrolases-like domain | chr5:25588254-25591229 FORWARD LENGTH=705

Transcript Sequence (2715 bp)

>PGSC0003DMT400017573 2715 pgsc_dm_v3.4
AAAAAAGGCAAGGGTAGTGTGCGATTCTCTCTCTCAAAACCCTCCAATGAATTTCTAGTG
AGAGAAAGAGAAAGAAGAAAACTCCGATTACATAAACACTGCGGCCTTGTTGGCTACAAA
TCGGAGCAATGAAAGTATCTAATGGAAACTGTAGTTGTGCAGTGGAAAGAGACGATAGTA
ATACTACTACAACTAGTAGTGTCAACGATAGTAATACTACGACTGGTAGTCTCAGTATAA
GTGGTGATGACGGCGCCGGAGAAGTGGGTGGAAGGGTGGTGGCAGTGGTGGGAGTGAAGT
TAGATTCCAGAAGTAAAGAGTTGCTTACTTGGGCTTTGGTTAAGGTTGCTCAGACTGGAG
ATCATGTAGTGGCTGTACATGTTATCGATCCAAATTCTGATAAATCAGAACCTCTTTCAC
TGGTGAAGTCATTTGACTTGATGCTGGCTGCTTATGAGGGCTTCTGCAATTTAAAGCAGG
TGCATTTGAAGCTTAAAGTCTGTCGAGGATCACCAGTTCGTAAAGTTCTTGCTCGCGAGG
CGAAATTGGAAAGTGCTATAAATTTGATTATTGGGACTTCAGGCAGTCATCATGCCATTC
GGTCGTCAGTGTCACTTGCAAAATACTGTGCTAGGAAAGTGACAAAGAGCATCTCTGTTA
TTGCCGTTGACAATGGCAAGATTGTTTATCAAAGGGAAGCTAGTGCTTTGGATGGAGATG
AATCTAGTGACTCAGATGTGCCCAAATCAAGATTCAAGAGGAGGAAGACACTGAACAAAA
GTCCTCTGAGCTTAATGCCTAAGAAAGCTGTGGAAGAAAACTCTTGTACAACAGAGAACA
ATTACATGGCTTTGGTGCCTGTTAAGCCTATTGAAGTCCGGGAGTCAAAGTCTCGCTGGA
CACTGCTTCGACGAGTTTTTCTTCAGAACATAGTGGCACCTGATAAATTTCCCGCAAAAA
GGTCTTCTGTGATGCATTGGGTTTGGAAACGACCAAGTCGGCAATCTTTTGCAGCTATCT
ACCCTGATCATAAACAGAGTGTATCTGACAAGGATGAGCCTCATTGTACAAACTTGGATG
AAGGGAAGGGGGCAATTATTCCTGTCGGAAGTGATGCTGATCCAATTTCAAATGAATGCT
TTATTGTCCTTCCTGAGGAACTGGAGGGTCTTACTGAAAGGTACTCATCAATGTGCAGAT
TGTTCAATTACCAGGAGCTTTGTTCAGCAACATCTGATTTCCTGCCAGAGAATTTGATTG
GAAAAGGAGGCAGCAGTAAGGTTTACAAAGGGTGCCTTCCAGATGGCAAGCAACTGGCTG
TGAAAATATTGAAGCCATCAGAAGCTGTGGCACAGCAATTCCGTTCAGAGATAGAGATAC
TCACAACTCTGCATCACAAGCACATTATATCACTGATTGGGTTTTGTTTAGAGGAGAACA
ACCTTTTACTGGTTTATGATCTGTTATCCAGAGGAAGCTTAGAAGAGAATCTCCATGGTT
CCAAAAAGGATGAAAATTCATTTAGCTGGGCAGATAGATACAAGGTTTCTTTGGGTGTTG
CTGAGGCACTGGACCACCTACACAATGCAGCTGATGGGCCCATAATCCACAGGGATGTGA
AATCTTCAAACATTCTCCTGTCCGATGATTCTGAGCCACAGCTTTCAGATTTTGGACTTG
CAACACCGGCCTCAAGCTGTTCAAATCATTTAGATAGCATTGATGTTGCTGGAACATTTG
GCTACTTGGCTCCTGAGTACTTTATGCATGGAAAGATAACTGAAAAGATTGACGTGTATG
CATTTGGTGTTGTTCTCCTTGAGCTTTTGTCTGGTAAAAAGCCAATTGATAATGGCAATG
GGAAAGGTCAGGAAAGCTTAGTCATGTGGGCGAAACAAGTTCTGAAGGGTGGGAACACGA
AGGAGTTGCTAGATCCGAGCTTGATTGACACTTATGATCATGATCAATTTGAGAGAATGG
TCTCGGCGGCATCACTGTGCATCAGACGAGCTCCTGGAATTAGACCTCAAATTGACATCG
TGGTAAAACTCCTCCAAGGTGAGGCTGAAACAATTAAGTGGGCGATTGAAGAAGGCAAAT
TTTCAGAAGAAGTAGATGCTGTCGATGGTGAACAACCACCCTCAAACATACAATCCTTTA
TTAATCTCGCATTGCTGAATTTGGAGGATGAGTCCTCACTTTCATGTACCAGCACGGGAC
CAACCATTTCCGTGGAGGATTATTTGCAAGGGAGATTTAGTCGCTCTTCAAGTTTTGACT
AACCATTCCTATGATAGATGTCTATGGCTATATATCAAGTAACCCTTTTTCTGTAAATAC
CGAGCTTTCCTTGTTGATTGATTGCCCCCATCACTGGGTCCTGGTACGAGAGGTTTACAG
CCATTAACCTCCTCCTTTGCCTAGCCTGGGATGATTTTTTCTTCAACTATCTCCTTTTTC
CACAGCTTCTTTTTGGGGTGTAGTAACAAATGCTGCCAAGAGTATGAGCAAATGATTAGT
AGATTGTCACAGGTGAGTTATTGTAAATCAAATCCAAAGTTGAGTTGTAATTAAACATCT
GAGTTCATATGTAGTTGTAAGAAAATAGCTTTAGTTGTCAATAGAGAGGTTTAACCATTT
CTGGAAATTCTACTCTTTGACCTGTTATTGCAACCTTAATTTTAGTTTGCAGAGAAGTGT
TTATTACTCTTGCTA