Microarray Probes on PGSC0003DMT400017452

Probe IDChipProbe Sequence
CUST_13461_PI426222305 JHI_St_60k_v1 GATCACGAGAATAAGAAGAAACATAGATAATGGTTCCCAGTTTTATGGTACCAAGTATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017452

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017452 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G12470.1 +1 4e-140 410 200/287 (70%) Protein of unknown function (DUF3411) | chr5:4044950-4047290 REVERSE LENGTH=386

Transcript Sequence (1321 bp)

>PGSC0003DMT400017452 1321 pgsc_dm_v3.4
CCAATGGCGGCCATCGCCACCGCCACGGCCACCTCCTACCTCTCTACCACCTCTCTCAGC
CGCCACCAATCTTCAACTTTTCGTTTCTCATCCCTCACTTACCCAATCAATTTTTCAACT
TTTTCACTTAATGCCCAATTTAATCCTCCTCGTACTTCCTTCCCCATATTCTCCACTCTC
AGTAATCACCACGGCGGCGGAAACATCGACGGCGGCGGAGGTGGCGGCGGAGGAAGTGGA
GGAGATGGAAGAGGAAAGGATGACGGGAATGCAGGGGAAAGGAACAAGAAAGAAGCAATA
ATGGCTTTGGCTGAAGCCGAAAGGACATTAGACAGCTTGCCTAAGGACTTGGCTTCCGCA
ATTGAAGCCGGGAAAATACCTCCGGCCGTCATTCACCGGTTTTTGGAGCTCGAAAAGTCA
CCGGTGCTCCGGTGGCTGCTCAGCTTTGGTGGATTTAGAGAACGGTTGCTGGCTGATGAT
CTTTTCTTAACTAAAGTTGCTATAGAGTGTGGCATTGGAATTTTTACTAAGAGTGCTGCA
GAGCTGGAGAAGCGTAGGGAGAATTTCACAAAGGAGCTGGACTTTGTCTGTGCTGATGTG
GTGATGGCCATTGTTGCTGATTTCATGCTGGTTTGGCTCCCAGCTCCTACTGTCGGTCTC
CGTCCTTCTCTTGCAATTGGCTCTGGGCCTCTTACTAAACTTTTCTACAACTGCCCGGAC
AATGCATTTCAGGTGGTGTTGTCTGGCACTTCCTATTCATTTTTACAGAGACTAGGCGCC
ATAGTGAGAAATGGGGCCAAACTATTTGCAGTTGGTTCAGGTGCATCTCTGGTTGGTACA
GGTGTAACAAACACTTTAATCAACGCACGGAAGGCTATTGATAAAACTTTTGCTGGTGAA
GCTGAGAATCTACCAGTTCTGTCTAGCAGTGCTGCCTATGGTGTTTACATGGCATTTTCA
AGCAACCTTAGGTATCAAATCCTTGCTGGAGTTATTGAACAACGAATATTGGAGCCCTTG
CTACACAAGAACAAGATCATGCTTGGTGCACTGTGCTTCGTTTTTCGAACTGGCAATACC
TTTTTGGGATCATTGATGTGGGTGGATTTTGCACGTTGGATTGGAATCCAAAGATCACGA
GAATAAGAAGAAACATAGATAATGGTTCCCAGTTTTATGGTACCAAGTATCATTTGTACA
ATTATTTTTTAAATTCAATTATAACAGTGGTGAGATTTTTTGGCACACTCTTTATCGGTG
CTTTATTTTGTTTAATTCAAAAGAAGTATGGCTTCAAAATCTCTTGATTGTGCAAAATTT
A