Microarray Probes on PGSC0003DMT400017300

Probe IDChipProbe Sequence
CUST_52530_PI426222305 JHI_St_60k_v1 ACGCTAGTAAGTGTTCGTGAGACATCCGATAAAATTAGAACGATATAACCAAAAGCTAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017300

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017300 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G16530.1 +3 3e-46 156 71/108 (66%) Auxin efflux carrier family protein | chr5:5400735-5402626 FORWARD LENGTH=351

Transcript Sequence (486 bp)

>PGSC0003DMT400017300 486 pgsc_dm_v3.4
GTGGAGTAGCCATGTTTAGTATGGGATTATTCATGGCTTTGCAAGGGAAAATAATTGCAT
GTGGAGCTGCATTGACAATTTATGCAATGATTTTGAGATTTGTTGTTGGACCAGCAACAA
TGGCACTTGGTTGTGTTGTATTGGGCTTGAGAGGAAATGTTTTACGTATCGCGATTATTC
AGGCTGCATTACCCCAAGCAGTGACATCTTTCGTATATGCTCAAGAATATGGACTTCATG
CTGATGTACTTAGCACTGCGGTGATTGTTGGCACCATAATTTCGTTACCTCTATTGATAG
CATATTATGCAATTTTGGATATTATGTCTTAAGATCCGACCATGAACTAACTAGATAGAC
GCTAGTAAGTGTTCGTGAGACATCCGATAAAATTAGAACGATATAACCAAAAGCTAGTAA
GAATGTTACTAATTAATGGGTACAACTTTGCTTGTAATTGTAAATTTGTAACAATTTTTG
TTATCT