Microarray Probes on PGSC0003DMT400017286

Probe IDChipProbe Sequence
CUST_52580_PI426222305 JHI_St_60k_v1 CATGATGGAATTAGAGAAGCAAGGGAAAATAGTACCATGGTGTTCACAACTTGAAGTCTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017286

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017286 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G15550.1 +2 1e-107 340 190/410 (46%) indole-3-acetate beta-D-glucosyltransferase | chr4:8877877-8879301 REVERSE LENGTH=474

Transcript Sequence (2290 bp)

>PGSC0003DMT400017286 2290 pgsc_dm_v3.4
CAATAATTAAGAGTCTTACAAGTCAATGATTTCTCTAACACAATACTAAAGTCTACTTTC
ATTCATTTGTCCTCGAACTTTGAACTTAGGTTCTATTTTTAAGTTTGTGAGTGTAAAAAT
GGTGCAACCCCATGTCCTCTTGGTGACATTTCCCGCACAAGGTCATATCAATCCATCTCT
TCAATTTGCCAAGAGGCTAATCAAAATGGGCATTGAGGTGACATTCACCACTAGCATTTT
CGCCCATCGTCGTATGGCGAAAACCGCGGCTTCCACCGCACCCAAGGGCTTAAACTTGGC
GGCATTCTCTGATGGATTTGATGATGGTTTCAAGTCTAACGTGGATGATTCTAAATGTTA
CATGTCGGAGATAAGAAGTCGTGGGTCTCAAACATTAAGGGATATCATTCTGAAGAGTTC
AGACGAGGGACGTCCTGTCACGTCCCTCGTCTACACTCTTCTGCTACCTTGGGCAGCTGA
GGTAGCGCGTGAACTCCACATTCCATCCGCGTTACTATGGATTCAACCAGCAACTGTGCT
AGACATATACTACTATTACTTCAATGGCTATGAGGATGAAATGAAGTGTAGCTCAAATGA
TCCAAATTGGAGTATCCAATTACCAAGGCTTCCATTACTAAAAAGCCAAGATCTTCCATC
CTTTTTAGTTTCATCTAGCTCTAAAGATGATAAGTATAGTTTTGCTCTACCAACATTTAA
AGAGCAACTAGACACATTAGATGGTGAAGAAAATCCAAAGGTACTTGTGAATACATTTGA
TGCATTAGAGCTAGAGCCACTCAAAGCTATTGAAAAATACAATTTAATTGGAATTGGACC
ATTGATTCCTTCATCATTCTTGGGTGGAAAAGATTCATTGGAATCTTCATTTGGTGGTGA
TCTTTTTCAAAAGTCAAATGATGACTACATAAAATGGTTAAGCACAAAGCGTAAATCATC
AATTGTTTATATCTCATTTGGGAGTCTATTGAATTTATCAAGAAACCAAAAGGAGGAGAT
TGCAAAAGGGTTGATAGAGATTAAAAGGCCATTCTTATGGGTAATAAGAGATCAAGAAAA
TATAAAAGAAGTAGAAAAAGAAGAAGAGAAATTAAGTTGCATGATGGAATTAGAGAAGCA
AGGGAAAATAGTACCATGGTGTTCACAACTTGAAGTCTTAACACATCCATCTTTAGGATG
TTTTGTCTCGCATTTTGGATGGAATTCAACTCTGGAGAGTTGTAGCTCAAATGATCCAAA
TTGGAGTATCCAATTACCAAGGCTTCCATTACTAAAAAGCCAAGATCTTCCATCCTTTTT
AGTTTCATCTAGCTCAAAAGATGATAAGTATAGTTTTGCTCTACCAACATTTAAAGAGCA
ACTAGACACATTAGATGGTGAAGAAAATCCAAAGGTACTTGTGAATACATTTGATGCATT
AGAGCTAGAGCCACTCAAAGCTATTGAAAAATACAATTTAATTGGAATTGGACCATTGAT
TCCTTCATCATTCTTGGGTGGAAAAGATTCATTGGAATCTTCATTTGGTGGTGATCTTTT
TCAAAAGTCAGATGATGACTACATGGAATGGTTAAACACAAAACCTAAATCATCAATTGT
TTATATCTCATTTGGGAGTCTATTAAATTTATCAAGAAACCAAAAGGAGGAGATTGCAAA
AGGGTTGATAGAGATTAAAAGGCCATTCTTATGGGTAATAAGAGATCAAGAAAATATAAA
AGAAGTAGAAAAAGAAGAAGAGAAATTAAGTTGCATGATGGAATTAGAGAAGCAAGGGAA
AATAGTACCATGGTGTTCACAACTTGAAGTCTTAACACATCCATCTTTAGGATGTTTTGT
CTCGCACTGTGGATGGAATTCGACTCTGGAGAGCCTGTCGTCAGGCGTACCTGTGGTGGC
ATTTCCTCATTGGACAGATCAAGGGACTAATGCAAAATTGATTGAAGATGTTTGGAAGAC
AGGTGTCAGGATGAGAGTGAGTGAAGATGGTGTGGTTGAGAGTGAAGAGATAAAAAGGTG
CATAGAAATTGTAATGGATGGTGGAGAAAAAGGAGAAGAAATGAGAAAGAATGCACAAAA
ATGGAAAGAATTGGCAAGAGAAGCTGTGAAAGAATGTGGATCTTCAGAAGTGAATCTAAA
AGCTTTTGTTCAAGAAGTTGGCAAAAGTTGTTGAAAAATTAAATTTCTTGATGAGAAATT
GTTTCCTAATTGTAATTTTCTTTTTTTTTTCACAATAAAATTTGGAGTTATATACATTGA
CCACGTAAAA