Microarray Probes on PGSC0003DMT400017198

Probe IDChipProbe Sequence
CUST_34325_PI426222305 JHI_St_60k_v1 GTTTCACTCAAGGATTTTATCACGGGTCGGATATTGTTAATCCTTTGAAAGCTAAAGAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017198

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400017198 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62180.1 +3 8e-107 322 162/323 (50%) carboxyesterase 20 | chr5:24978866-24979849 REVERSE LENGTH=327

Transcript Sequence (1287 bp)

>PGSC0003DMT400017198 1287 pgsc_dm_v3.4
GACTCATCTTAACGAATACCAAAGAGTTGACTTGCCAACCATGTATACACACTACTCTTT
ATTTTAAAGAATTGCTCATACATTCACAATCTTCTATCTCTAAACACTGTATTACAAGCA
TGTCTGATCAAAATCTTGAAACTATGTCAATTGATCCTAATGTTGATCCCTATGGCTATT
TGGGCATGGTTCGTAATTCTGATGGTTCCATCACACGTCTACAAAACCCTCTTGTTCCGA
TAGACACATCTAATGATCTTTCCCATCTAGTCGTCACCAAAGATATTACTATTAACTCCT
CAAAGAACACATGGGCACGTATTATACTCCCTCGTGACCTTCTCCATTCCACCACCAGTA
CTCCTAAACTTCCTCTCGTGATCTATTTTCACGGAGGAGGATTCATAGTAGCAACTGTAG
ATTCACCTAGCTTTCAAGGATTTTACGCGTCAATTGCTAGTGAAATTCCAGCAGTTGTTG
TATCAATTGAGTATCGTCAAGCCCCCGAGCATAGACTTCCAGCAGCATACGACGATTGCA
TGGAAGCATTGCATTGGATCAAGAACAAACCCGACGAGCTATTATCCAACCACGCTGATT
TCTCCAAATGCTTCCTAATGGGCACGAGTGCCGGAGGTAACGTGGTGTACCACGTGGGCC
TACACGCCGCGGAGAGTAGGGAAAACCTCAAGCCTTTGGAAATCAAGGGGTTGATATTGA
ATCAACCTTTCTTTGGTGGGAGTGAGAGGACACAATCAGAAGTAAGATTGGCTAATGACA
AGGTGTTACCCCCAATTATAAGTGATATCATGTGGGACCTAGGATTGCCTGAAGGTGCTA
ATCGCGATCATGAGTATTCAAATCCAATGGTGGGGATTGAATCAAACCCAAACCTATTGG
ATCAAGTAAAATTATTAGGATGGAAGATGTTGGTGACTGGCTGTGACGGCGATCCTTTAA
TTGATCGCCAAGTTGACCTAGTGAAGGTGTTGAAAGAATTGGGCGTTCAAGTAGAGGGTA
GTTTCACTCAAGGATTTTATCACGGGTCGGATATTGTTAATCCTTTGAAAGCTAAAGAAT
TTTCCTTGCTTGTAAAGGAACTTATAAGCCACGTTTAAGGGGAATTGCTTTGTATAATTG
TAATAGTATTAGTATGGCCCCTCCCCAAAAATGTGATAGCGGATAAGCAGATCTGCCAAG
ATTATGTAATGATGCATATTAATTATTAATATAATATCTTGTTTACCCAAAAATAAAAGA
AACTTCACTACTATCCTTGAATAATAT